Ribomax large scale rna production t7 kit

mRNA preparation was carried out as described by Dmitriev et al. (2007) (link). Briefly, PCR products were obtained with a forward
primer containing the T7 promoter (either the universal primer which anneals to the
vector sequence immediately upstream of insertions,
CGCCGTAATACGACTCACTATAGGGAGCTTATCGATACCGTCG or the T7 promoter-containing gene
specific primer) and reverse primer containing an oligo(dT) stretch of 50 nt
T50AACTTGTTTATTGCAGCTTATAATGG. To introduce stem loop structure, PCR products were
obtained with forward primer containing the T7 promoter:
CGCCGTAATACGACTCACTATAGGGAGTGGACTTCGGTCCACTCCCAGCTTATCGATACCGTCG. To introduce the
CAA₆ sequence upstream of the IFRD1 uORF, the following primer was
used: CGCCGtaatacgactcactataGGGCAACAACAACAACAACAACAACATGTATCGTTTTCGATCACAGCTC.
The PCR products were then purified and used as templates for T7 RNA polymerase using
in vitro RNA transcription by T7 RiboMAX Large Scale RNA Production kit (Promega,
Fitchburg Center, WI). For preparation of m7G-capped transcripts the
3′-O-Me-m7GpppG (ARCA cap analogue, New England Biolabs,
Ispwich, MA) was added to the transcription mix without GTP for 5 min to prime
transcripts with cap followed by the addition of GTP (at a ratio of ARCA:GTP 10:1).
The resulting RNAs were purified by LiCl precipitation and examined for integrity by
PAGE.

The barley stripe mosaic virus (BSMV)-based VIGS method was used to create gene knockdown plants (Ma et al., 2012 (link); Dong et al., 2019 (link)). Briefly, a 283-bp fragment of wheat ATG8 from the conserved coding sequence was amplified and purified, with a same-sized fragment of GFP used as a control. The γ strand of BSMV was then digested in XmacI and fused with the ATG8 or GFP fragment to form the vectors BSMVγ-ATG8 and BSMVγ-GFP, respectively. BSMV-α was then linearized with MIuI, BSMV-β was linearized with SpeI, and BSMVγ-ATG8 and BSMVγ-GFP were linearized with BssHII then the linearized vectors were transcribed in vitro to produce 5ʹ-capped infectious BSMV RNA molecules using the RiboMAX Large-Scale RNA Production-T7 Kit (Promega, Madison, WI, United States), with a cap analog added to the transcription mixture. They were then mechanically infected with a 1:1:1 mixture of RNAα, RNAβ and RNAγ-ATG6, or RNAγ- GFP in 1 × GKP buffer (50 mM Gly, 30 mM K2HPO3, 1% bentonite and 1% kieselguhr). In the field, inoculation of BSMV was performed at the heading stage by inoculating 50 spikes with 20 µL of BSMV-ATG8 or BSMV-GFP transcript mixture, respectively.