Liproxstatin 1

Manufactured by Selleck Chemicals

Sourced in United States, Morocco

Liproxstatin-1 is a chemical compound used in laboratory research. It functions as a potent and selective inhibitor of ferroptosis, a specific form of programmed cell death. The core function of Liproxstatin-1 is to serve as a tool for studying cellular processes and pathways related to ferroptosis in controlled experimental settings.

Automatically generated - may contain errors

Lab products found in correlation

Close spelling variants of this product

Liproxstatin-1 (Lip-1; (5 citations)

49 protocols using liproxstatin 1

Compound Cytotoxicity Screening in Cell Lines

Check if the same lab product or an alternative is used in the 5 most similar protocols

Cells were seeded onto 96-well plates (2000 cells per cell) and treated with the compounds [RSL3 (Selleck Chemicals), Erastin (Selleck Chemicals), Thrombin (Abcam), Liproxstatin-1 (Selleck Chemicals), Pioglitazone (Sigma-Aldrich), DMSO, Dabigatran (Selleck Chemicals), Trifluoroacetic acid (TFA, Sigma-Aldrich), Darapladib (Selleck Chemicals), NAC (Beyotime)] after plating. Cell viability was assessed at different time points after treatment (24 h unless stated otherwise) using Cell Counting Kit-8 (CCK-8) cytotoxicity assay (Bimake, B34304), as previously described.^{13 (link)} The cell death curve of RSL3 in N27 cells, as well as Thrombin in MDA-MD-231 cells, are shown in Fig. S5.

Tuo Q.Z., Liu Y., Xiang Z., Yan H.F., Zou T., Shu Y., Ding X.L., Zou J.J., Xu S., Tang F., Gong Y.Q., Li X.L., Guo Y.J., Zheng Z.Y., Deng A.P., Yang Z.Z., Li W.J., Zhang S.T., Ayton S., Bush A.I., Xu H., Dai L., Dong B, & Lei P. (2022). Thrombin induces ACSL4-dependent ferroptosis during cerebral ischemia/reperfusion. Signal Transduction and Targeted Therapy, 7, 59.

+ Open protocol

+ Expand

Cisplatin Sensitivity in GC Cell Lines

Check if the same lab product or an alternative is used in the 5 most similar protocols

The GC cell lines (SGC7901, BGC823, SGC7901/DDP, BGC823/DDP) were stimulated with the indicated doses of cisplatin. Furthermore, the SGC7901/DDP and BGC823/DDP cells were treated with ferroptosis agonist erastin (0.8 µM), RSL3 (0.1 µM) or antagonist liproxstatin-1 (80 nM, both from Selleck, Houston, Texas, USA) before and during cisplatin exposure [11 (link)].

Fu D., Wang C., Yu L, & Yu R. (2021). Induction of ferroptosis by ATF3 elevation alleviates cisplatin resistance in gastric cancer by restraining Nrf2/Keap1/xCT signaling. Cellular & Molecular Biology Letters, 26, 26.

+ Open protocol

+ Expand

Comprehensive Cell Signaling Reagents Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols

Dulbecco's modified Eagle's medium (DMEM) and foetal bovine serum (FBS) were obtained from Gibco. Earle's balanced salt solution (EBSS) and propranolol were purchased from Sigma‐Aldrich. Rapamycin (RAPA), 3‐methyladenine (3‐MA) and chloroquine (CQ) were obtained from MedChemExpress, and ZVAD‐FMK, necrostatin‐1, liproxstatin‐1, SB203580, SP600125, SC79 and 740Y‐P were purchased from SelleckChem. Then, these reagents were dissolved in dimethyl sulfoxide (DMSO) (MP Biomedicals or water and stored at −80°C. Primary antibodies against Akt, p‐Akt, p38 MAPK, p‐p38 MAPK, JNK, p‐JNK, Erk1/2 and p‐Erk1/2 were purchased from Cell Signalling Technology. Primary antibodies against alpha‐smooth muscle actin (α‐SMA), fibronectin (FN), LC3B, P62, p‐PI3K p85, PI3K p85, ATG9b, ATG9a, mTOR, p‐mTOR, ATG12, ATG5 and anti‐ubiquitin were procured from Abcam. Primary antibodies against beta‐actin, alpha‐tubulin, GAPDH and HRP‐conjugated secondary antibodies were obtained from Proteintech. DyLight 549‐conjugated and DyLight 488‐conjugated secondary antibodies were provided by Abbkine.

Wang S., Ding Q., Xiu A., Xia Y., Wang G, & Zhang C. (2023). Upregulation of ATG9b by propranolol promotes autophagic cell death of hepatic stellate cells to improve liver fibrosis. Journal of Cellular and Molecular Medicine, 28(2), e18047.

+ Open protocol

+ Expand

Ferroptosis Regulation Pathways Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Assay kits for the detection of cell survival (CCK8 kit) was purchased from Beyotime (Shanghai, China). GSH and MDA were obtained from MedChemExpress (Shanghai, China). Sorafenib, Ferrostatin-1 and Liproxstatin-1 were purchased from Selleck Chemicals (Shanghai, China). ZVAD-FMK, Necrostatin and Necrosulfonamide were obtained from Sigma-Aldrich (Shanghai, China). Metformin was obtained from aladdin (Shanghai, China). Antibodies against, including Nrf2, HO-1, P62, Keap1 and β-actin, were obtained from MedChemExpress (Shanghai, China). Nrf2 siRNA (GTTGCCCACATTCCCAAATCA) and P62 siRNA (GAACAGAGCGGGATCAAGAAT) were designed and constructed by QIAGEN (Shanghai, China).

Tang K., Chen Q., Liu Y., Wang L, & Lu W. (2022). Combination of Metformin and Sorafenib Induces Ferroptosis of Hepatocellular Carcinoma Through p62-Keap1-Nrf2 Pathway. Journal of Cancer, 13(11), 3234-3243.

+ Open protocol

+ Expand

Ferroptosis Induction in Gallbladder Cancer

Check if the same lab product or an alternative is used in the 5 most similar protocols

ISL was acquired from Sigma-Aldrich Corp. (St. Louis, MO, USA), and the structure of ISL is shown in Supplementary Figure 1, http://links.lww.com/CM9/B518. Ferrostatin-1, liproxstatin-1, and deferoxamine were obtained from Selleck Chemicals (Houston, TX, USA). Z-VAD-FMK, necrostatin-1, and zinc protoporphyrin (ZnPP) were acquired from MedChem Express (Monmouth Junction, USA). ISL was dissolved in DMSO at a concentration of 100 mmol/L and diluted with culture medium at the indicated concentrations, while the control groups were treated with the same volume of DMSO. The standard curve between the concentration of ISL (μmol/L) and the viability (%) of GBC cells was analyzed by logarithmic correlation regression with a regression equation. Ferrostatin-1, deferoxamine, liproxstatin-1, Z-VAD-FMK, necrostatin-1, and ZnPP were dissolved in DMSO, and tumor cells were incubated with final concentrations of 1 μmol/L Ferrostatin-1, 1 μmol/L liproxstatin-1, 50 μmol/L deferoxamine, 50 μmol/L Z-VAD-FMK, 50 μmol/L necrostatin-1, 4 μmol/L or 10 μmol/L ZnPP for 1 h followed by ISL treatment at an inhibitory concentration of 25% (IC25) for 48 h.

Wang Z., Li W., Wang X., Zhu Q., Liu L., Qiu S., Zou L., Liu K., Li G., Miao H., Yang Y., Jiang C., Liu Y., Shao R., Wang X, & Liu Y. (2023). Isoliquiritigenin induces HMOX1 and GPX4-mediated ferroptosis in gallbladder cancer cells. Chinese Medical Journal, 136(18), 2210-2220.

+ Open protocol

+ Expand

Comprehensive Anticancer Compound Evaluation

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

CB-839, mitomycin C, cryptotanshinone, altretamine, GSK583, liproxstatin-1, spautin-1, PD-1/PD-L1 inhibitor 2, RVX-208, selinexor, ferrostatin-1, diacerein, LY2603618, and patupilone were purchased from Selleckchem (Houston, TX). Cisplatin, carboplatin and oxaliplatin were purchased from Sigma-Aldrich (St. Louis, MO). Olaprib, niraparib, veliparib were purchased from Cayman Chemical (Ann Arbor, MI). As₂O₃ was purchased from BioTang (Lexington, MA). C1–27 is a GSTO1 inhibitor previously identified and synthesized by our laboratory (5 (link)).

Xu Y., Bankhead A I.I.I., Tian X., Tang J., Ljungman M, & Neamati N. (2020). Deletion of Glutathione S-Transferase Omega 1 Activates Type I Interferon Genes and Downregulates Tissue Factor. Cancer research, 80(17), 3692-3705.

+ Open protocol

+ Expand

Ferroptosis Pathway Modulation in CRC Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

Human CRC cell lines (HCT116, LoVo, HT29) were purchased from ATCC, these cells were cultured in McCoy’s 5A or Dulbecco’s modified Eagle’s medium (DMEM; Gibco BRL, Rockville, MD, United States) with 10% heat-inactivated fetal bovine serum at 37°C, 95% humidity, and 5% CO₂. The fetal bovine serum was purchased from Corille (184590, Australia). RSL3 (#S8155) and liproxstatin-1(#S7699) and ferrostatin-1 (#S7243) were purchased from Selleck Chemical (Houston, TX, United States). Z-VAD-FMK (#V116), deferoxamine (#D9533), necrostatin-1 (#N9037), chloroquine (#C6628), and doxorubicin (#D1515) were obtained from Sigma. Ferritin (ab75973), transferrin (ab82411) and GPX4 (ab125066) were purchased form Abcam; GAPDH (#5174) was obtained from Cell Signaling Technology (CST). GPX4 plasmid (RG208065) was purchased from OriGene.

Sui X., Zhang R., Liu S., Duan T., Zhai L., Zhang M., Han X., Xiang Y., Huang X., Lin H, & Xie T. (2018). RSL3 Drives Ferroptosis Through GPX4 Inactivation and ROS Production in Colorectal Cancer. Frontiers in Pharmacology, 9, 1371.

+ Open protocol

+ Expand

Western Blot Analyses of Cell Signaling

Check if the same lab product or an alternative is used in the 5 most similar protocols

The antibodies to NRF2 (#12721), p-ERK1/2 (#4370), ERK (#9102), actin (#3700), glyceraldehyde 3-phosphate dehydrogenase (GAPDH, #5174), and β-tubulin (#2146) were obtained from Cell Signaling Technology (Danvers, MA, USA). The antibodies to NRF2 (#ab62352), Keap1 (#ab150654), and Lamin B1 (#ab16048) were obtained from Abcam (Cambridge, MA, USA). The antibodies to p62 (#sc-28359) and MafG (#sc-133770) were obtained from Santa Cruz. Cycloheximide (#C7698), MG-132 (#M7749), deferoxamine (#D9533), Z-VAD-FMK (#V116), necrostatin-1 (#N9037), and alkaloid trigonelline (#T5509) were obtained from Sigma (St. Louis, MO, USA). Necrosulfonamide (#480073) was obtained from EMD Millipore Corporation (Darmstadt, Germany). Erastin (#E7781), sorafenib (#S7397), ferrostatin-1 (#S7243), and liproxstatin-1 (#S7699) were obtained from Selleck Chemicals (Houston, TX, USA).

Sun X., Ou Z., Chen R., Niu X., Chen D., Kang R, & Tang D. (2015). Activation of the p62-Keap1-NRF2 Pathway Protects against Ferroptosis in Hepatocellular Carcinoma Cells. Hepatology (Baltimore, Md.), 63(1), 173-184.

+ Open protocol

+ Expand

Ferroptosis Inhibition and ACSL4 Modulation in Ischemia

Cited 2 times

Check if the same lab product or an alternative is used in the 5 most similar protocols

Liproxstatin-1 (S7699, Selleck, TX, USA), a ferroptosis inhibitor, was administered i.p. at a concentration of 10 mg/kg 1 h before ischemia induction, in accordance with previous study protocols [9 (link)]. Mice were killed at 30 min of reperfusion and serum was collected from the abdominal aorta. In addition, Liproxstatin-1 dissolved to a final concentration of 200 nM was used to treat Caco-2 cells in vitro for 12 h before hypoxia induction. Rosiglitazone (ROSI, S2556, Selleck), a classic peroxisome proliferator-activated receptor-γ agonist that has been used for ACSL4 inhibition, was administered intravenously at a concentration of 0.4 mg/kg 1 h before ischemia induction, as pretreatment of ROSI allows sufficient time for proper phospholipid remodeling in the membranes [21 (link), 22 (link)]. Mice were killed at 45 min of ischemia or at 30 min of reperfusion. Serum was collected from the abdominal aorta. Kits were used to assay the levels of tumor necrosis factor (TNF)-α (ab208348, Abcam, MA, USA), interleukin (IL)-6 (ab100712, Abcam), and ACSL4 activity (ab241005, Abcam).

Li Y., Feng D., Wang Z., Zhao Y., Sun R., Tian D., Liu D., Zhang F., Ning S., Yao J, & Tian X. (2019). Ischemia-induced ACSL4 activation contributes to ferroptosis-mediated tissue injury in intestinal ischemia/reperfusion. Cell Death and Differentiation, 26(11), 2284-2299.

+ Open protocol

+ Expand

Comprehensive Toolkit for Cancer Research

Check if the same lab product or an alternative is used in the 5 most similar protocols

RSL3 (S8155), neratinib (S2150), lapatinib (S2111), gefitinib (S1025), ML210 (S0788), afatinib (S1011), dacomitinib (S2727), sapitinib (S2192), Z-VAD-FMK (S7023), necrostatin-1 (S8037), 3-Methyladenine (3-MA, S2767), tucatinib (S8362), liproxstatin-1 (S7699), erastin (S7242), deferoxamine mesylate (DFO, S5742), deferiprone (S4067), ferrostatin-1 (S7243), cobimetinib (S8041), Trastuzumab (A2007) and AZD6738 (S7693) were obtained from Selleck Chemicals. L-glutathione (G6013) and N-Acetyl-l-cysteine (A9165) were purchased from Sigma-Aldrich. T-DM1 (HY-P9921) was obtained from MedChemExpress.

Park S.Y., Jeong K.J., Poire A., Zhang D., Tsang Y.H., Blucher A.S, & Mills G.B. (2023). Irreversible HER2 inhibitors overcome resistance to the RSL3 ferroptosis inducer in non-HER2 amplified luminal breast cancer. Cell Death & Disease, 14(8), 532.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!