The largest database of trusted experimental protocols

Adp luciferase assay

Manufactured by Promega

The ADP luciferase assay is a laboratory equipment product designed to measure the concentration of ADP (adenosine diphosphate) in a sample. It utilizes a luciferase-based detection system to quantify the amount of ADP present.

Automatically generated - may contain errors

2 protocols using adp luciferase assay

1

Purification and Characterization of TbIPMK

Check if the same lab product or an alternative is used in the 5 most similar protocols
The T. brucei gene encoding IPMK was cloned into pET-29a (Novagen) and expressed in Escherichia coli DE3 pLysS Rosetta cells. Recombinant protein was purified using nickel-resin (Cestari and Stuart, 2015 (link)). Protein activity was assayed using the ADP luciferase assay (Promega). IPs and diC8 PIs were purchased from Echelon Biosciences. Assays were performed in 25 µl reactions in 96 well-plates using 20 mM HEPES, 150 mM NaCl, 2 mM MgCl2 at pH 7.5 at 37°C and 270 nM rTbIPMK. Substrate an alysis was performed for 60 min. with 50µM of each substrate, and dose-response assays were performed with 1–200 µM of Ins(1,4,5)P3 or Ins(1,2,4,5)P4 for 30 min. For inhibition assays all compounds were diluted in water and reaction mixes incubated for 30 min. Ins(1,4,5)P3, Ins(1,3,4,5)P4 and ATP were used at 30, 40 and 50 µM, respectively. For Ki analysis and mechanisms of enzyme inhibition, reactions were prepared with 10, 30 and 60 µM of Ins(1,4,5)P3 and C44 (0, 1, 5, 10 and 25 µM) or C52 (2, 10, 20 and 40 µM). Kinetic analyses were calculated by non-linear regression using GraphPad Prism for Windows 5.03 (GraphPad Software, Inc). Compound analogs were identified using an atom pair method and Tanimoto coefficients using ChemmineR (Cao, et al., 2008 (link)).
+ Open protocol
+ Expand
2

Enzymatic Characterization of Trypanosome IPMK Mutants

Check if the same lab product or an alternative is used in the 5 most similar protocols
The T. brucei gene encoding IPMK was cloned into pET-29a (Novagen) and expressed and purified from E. coli DE3 pLysS Rosetta cells (Novagen) as previously reported (Cestari et al., 2016 (link)). Site-directed mutagenesis of IPMK was performed using the pET-29-IPMK construct and a Q5 site-directed mutagenesis kit (New England Biolabs) according to the manufacturer's instructions. The forward and reverse primers used in site-direct mutagenesis reactions were as follows: D142A: TTGTGTGCTTGCTATCAAACTTG and GGTTTATGAAATGTCGCG, K164W: GCGCATACATTGGAGGCAGCTTC and TCCACCTTGTCGGGTAAT, and D142A/K144A: GCTTGCTATCGCACTTGGATATGTG and ACACAAGGTTTATGAAATGTC. Protein activity was assayed in 30-µl reactions in 96-well plates in a buffer consisting of 20 mM HEPES, 150 mM NaCl, and 2 mM MgCl2 (pH 7.5). The reactions also contained 300 nM rTbIPMK WT or a mutant version thereof, 5–200 mM Ins(1,4,5)P3 or Ins(1,2,4,5)P4 (Echelon Biosciences), and 200 µM of ATP. Reactions were incubated for 60 min at 37°C, after which IMPK activity was measured using the ADP luciferase assay (Promega; Cestari et al., 2016 (link)) and a Glomax plate reader (Promega). Kinetic analyses were calculated by nonlinear regression using GraphPad Prism for Windows 5.03 (GraphPad Software).
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!