To validate miRNA targeting, the 3’UTRs of HER2 and HER3 were cloned into the pGL3 firefly luciferase reporter plasmid. Cells were transfected in 48-well plates with 20 ng of pGL3 reporter, 2 ng of pRL-TK as the control, and 100 nM miRNA mimic. Firefly luciferase and Renilla luciferase activities were measured consecutively with the dual luciferase reporter system (Promega), and the firefly luciferase activity was normalized to that of Renilla luciferase after 48 h. To test the ceRNA activity of the HER2 3’UTR, 5× 104 293 T cells were transfected in 48-well plates with 20 ng of pGL3-HER3 3’UTR and 250 ng of pCDNA3.1-HER2 3’UTR or pCDNA3.1 as a control, as well as 1–10 nM miRNA mimic. Firefly luciferase and Renilla luciferase activities were measured consecutively with the dual luciferase reporter system (Promega), and the firefly luciferase activity was normalized to that of Renilla luciferase after 48 h.
Dual luciferase reporter system
Manufactured by Promega
Sourced in United States, China, Germany, Switzerland, Netherlands, Australia
The Dual-Luciferase Reporter System is a versatile tool for gene expression analysis. It utilizes the enzymatic activities of firefly and Renilla luciferases to enable the simultaneous quantification of two independent reporter gene activities within a single sample. The system provides a rapid and reliable method for normalizing experimental reporter data.
Automatically generated - may contain errors
Lab products found in correlation
Lipofectamine 2000, by Thermo Fisher Scientific (158 mentions)
Lipofectamine 3000, by Thermo Fisher Scientific (72 mentions)
Pmirglo vector, by Promega (42 mentions)
Prl tk, by Promega (32 mentions)
Passive lysis buffer (plb), by Promega (29 mentions)
Lipofectamine 2000 reagent, by Thermo Fisher Scientific (25 mentions)
Pgl3 basic vector, by Promega (24 mentions)
Lipofectamine 3000 reagent, by Thermo Fisher Scientific (18 mentions)
Psicheck 2 vector, by Promega (17 mentions)
Pgl3 vector, by Promega (16 mentions)
Pmirglo dual luciferase vector, by Promega (13 mentions)
Pmirglo dual luciferase mirna target expression vector, by Promega (12 mentions)
Psicheck 2, by Promega (12 mentions)
Pgl3 luciferase vector, by Promega (11 mentions)
Attractene transfection reagent, by Qiagen (10 mentions)
Dual luciferase reporter assay system, by Promega (9 mentions)
Psi check, by Promega (8 mentions)
Pmirglo, by Promega (8 mentions)
Pmirglo plasmid, by Promega (8 mentions)
Lipofectamine 2000 transfection reagent, by Thermo Fisher Scientific (8 mentions)
964 protocols using dual luciferase reporter system
1
Validating miRNA Targeting in HER2/HER3 Signaling
2
Regulation of PINCR Promoter Activity
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
A 2 kb region upstream of the first exon of PINCR was PCR amplified (primer sequences in Supplementary file 5 ) using 100 ng genomic DNA from HCT116 cells and inserted into upstream of Firefly luciferase of pGL3 luciferase vector (Promega). To measure PINCR promoter activity, HCT116 cells were co-transfected with 100 ng of pGL3-empty vector or pGL3 expressing the PINCR promoter, along with pCB6-empty vector or pCB6 expressing p53, and 10 ng pRL-TK expressing Renilla luciferase. After 48 hr, luciferase activity was measured using the dual-luciferase reporter system (Promega).
A 2 kb PINCR promoter region (chrX: 43,034,255–43,036,255) with (WT-p53RE) and without (Δp53RE) the 20 bp p53RE (GCCCTTGTCTGGACATGCCC) was synthesized in pGL3 luciferase vector by GenScript. HCT116 cells were co-transfected with 100 ng of pGL3 expressing the WT or Δp53RE PINCR promoter and 10 ng pRL-TK expressing Renilla luciferase. After 48 hr, cells were left untreated or treated with DOXO for 24 hr and luciferase activity was measured using the dual-luciferase reporter system (Promega).
A 2 kb PINCR promoter region (chrX: 43,034,255–43,036,255) with (WT-p53RE) and without (Δp53RE) the 20 bp p53RE (GCCCTTGTCTGGACATGCCC) was synthesized in pGL3 luciferase vector by GenScript. HCT116 cells were co-transfected with 100 ng of pGL3 expressing the WT or Δp53RE PINCR promoter and 10 ng pRL-TK expressing Renilla luciferase. After 48 hr, cells were left untreated or treated with DOXO for 24 hr and luciferase activity was measured using the dual-luciferase reporter system (Promega).
3
miR-182 Target Validation by Luciferase Assay
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The 3′-untranslated region (UTR) luciferase assay was used for the pmirGLO dual-luciferase miRNA target expressions vector (Hanheng, Shanghai, China). The cells were seeded at a density of 5 × 103 per well in six-well plates, and hsa-miR-182 mimics, and wild-type or mutant target sequences were co-transfected into each well using Lipofectamine 2000 (Invitrogen). Cells were then harvested at 48 h after transfection, and were cultured at 48 h. The activity of Freon was used by the dual-luciferase reporter system (Promega) was used for analysis. The activity of Renilla luciferase was used by the dual-luciferase reporter system (Promega). The average value of the results of the miR-control transfected cells was set to 1.0.
4
Daphnia Sir2 Transcriptional Regulation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Cos-1 cells were co-transfected with Daphnia Flag-Sir2/pcDNA3.1- expression construct along with 1 ng pRL null (Promega) and 250 ng pGL4.41 (Promega) using Effectene (Qiagen) as per the manufacturer's instructions. pGL4.41 has the firefly luciferase gene under the control of 4 tandem copies of a consensus mammalian heat shock element (HSE). 24h after transfection the cells were treated with 30 μM CdCl2 to induce proteotoxic stress. For treatment with CdCl2, the culture medium was removed and replaced with DMEM with charcoal stripped FBS containing 30 μM CdCl2. Six hours following the addition of CdCl2, the cell extracts were harvested and the luciferase activity was measured using the Promega dual luciferase reporter system as per the manufacturer's instructions. The firefly luciferase activity was normalized to the Renilla luciferase activity to account for differences in transfection efficiencies in different samples. Fold induction following cadmium chloride treatment was calculated for each set by dividing the normalized luciferase activity (firefly luciferase activity divided by the Renilla luciferase activity) in the cadmium treated samples by the normalized luciferase activity in untreated samples. The control represents the fold induction obtained with pGL4.41 reporter co-transfection with empty vector pcDNA3.1- following cadmium chloride treatment.
5
Evaluating miR-128-3p Binding to NEAT1 and ITGA5
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Wild-type and mutant NEAT1 or ITGA5 genes were subcloned into psi-CHECK2 vectors (Promega). Whereafter, the vectors were co-transfected into 293T cells alongside miR-128-3p mimics or negative controls. Luciferase activities were measured after 48 h and normalized to those of Rluc, using the Promega Dual Luciferase Reporter system (Promega) according to the manufacturer’s recommendation.
6
Luciferase Reporter Assay for ID1
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Id1 luciferase reporter assay was performed as previously described [30 (link)]. Briefly, cells at 70%–80% confluence were cotransfected with pGL4[luc2P/hID1/Hygro] Vector (Promega, Fitchburg, WI, http://www.promega.com ) and Renilla control vector (Promega) by using Lipofectamine 2000 (Life Technologies). After transfection for 6 hours, cells were treated with 20 μM phenamil. After 48 hours of treatment, luciferase activities were measured by using a dual luciferase reporter system (Promega) and normalized with Renilla internal control values.
7
Transcriptional Activation Assay
8
COUP-TFII Knockdown Luciferase Assay
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The U87 cells were cultured at a density of 10,000 cells/well in 96-well plates, and infected with 5 µl lenti-si COUP-TFII or lenti-siNC (6 µg/ml), and incubated with 2 µl Lipofectamine® 2,000 and 0.2 µg MPC1 luciferase reporter vectors (Thermo Fisher Scientific, Inc.). Following 48 h of incubation, luciferase activity was measured using a Dual-Luciferase Reporter system (Promega Corporation, Madison, WI, USA). The luciferase enzyme activity was normalized to the Renilla luciferase enzyme activity, All controls used were untreated cells.
9
Celastrol Modulates Transcriptional Activity
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
TOPFLASH or FOPFLASH reporter and control plasmid pRL-TK were transfected into
HEK293 cells, respectively. After transfection for 24 h, cells were treated with
or without Celastrol (0.5 μM) for another 24 h. Luciferase activity was detected
using the Dual Luciferase Reporter system (Promega) according to the
manufacturer’s instructions.
HEK293 cells, respectively. After transfection for 24 h, cells were treated with
or without Celastrol (0.5 μM) for another 24 h. Luciferase activity was detected
using the Dual Luciferase Reporter system (Promega) according to the
manufacturer’s instructions.
10
Transcription Factor Binding Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Segments of lncRNA2919 promoter sequences were cloned into pGL3-Basic vectors. TFs in the promoter region were predicted referring to the JASPAR database (http://jaspar.genereg.net/ (accessed on 1 November 2020)) [49 (link)]. The mutation type of TF binding sites was determined using Mut Express II Fast Mutagenesis Kit V2 (Vazyme, Nanjing, China), and the primers used are listed in Table S6 . After cell transfection, luciferase activity was determined using the dual-luciferase reporter system (Promega, Madison, WI, USA), and firefly luciferase activity was normalized to the corresponding Renilla luciferase activity.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!