Log In Sign up
The largest database of trusted experimental protocols

Pcr primers

Manufactured by GenScript
Visit Supplier
Sourced in China

PCR primers are short, synthetic DNA sequences used in the Polymerase Chain Reaction (PCR) process to amplify specific regions of DNA. They serve as the starting points for DNA synthesis, allowing the targeted DNA sequence to be replicated and detected.

Automatically generated - may contain errors

Lab products found in correlation

M mul 5, by Takara Bio (1 mentions) Sybr primescript rt pcr kit, by Takara Bio (1 mentions) Trizol reagent, by Thermo Fisher Scientific (1 mentions) Penicillin, by Thermo Fisher Scientific (1 mentions) Streptomycin, by Thermo Fisher Scientific (1 mentions) Trypsin, by Thermo Fisher Scientific (1 mentions) Fetal bovine serum (fbs), by Sartorius (1 mentions) Polyvinylidene difluoride pvdf membrane, by Merck Group (1 mentions) Rpmi 1640, by Thermo Fisher Scientific (1 mentions) Lipofectamine 3000, by Thermo Fisher Scientific (1 mentions) Reverse transcriptase, by Tiangen Biotech (1 mentions) Trizol reagent, by Tiangen Biotech (1 mentions) Sybr green qpcr supermix, by Thermo Fisher Scientific (1 mentions) Trizol, by Thermo Fisher Scientific (1 mentions) Anti bnp antibody ab19645, by Abcam (1 mentions) Complete freund s adjuvant, by Merck Group (1 mentions) Bx51 light microscope, by Olympus (1 mentions)

5 protocols using pcr primers

1

Quantitative PCR Analysis of Breast Cancer Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was isolated from breast cancer cell lines using the TRIzol reagent (Invitrogen, Carlsbad, CA, USA), and RNA was reverse transcribed into cDNA using M-MuLV reverse transcriptase (Takara Bio, Otsu, Japan). Quantitative real-time polymerase chain reaction (qRT-PCR) was performed using the Cobas z 480 detection system (Roche, Basel, Switzerland) and SYBR Prime-Script RT-PCR kit (Takara Bio, Otsu, Japan). The following PCR primers were used (Genscript. Nanjing, China):
Results were normalized to respective internal controls. The Ct-value for each sample was calculated using the ΔΔCt method, and results were expressed as 2−Δ;ΔCt.
Jia L., Yang X., Tian W., Gou S., Huang W, & Zhao W. (2018). Increased Expression of c-Met is Associated with Chemotherapy-Resistant Breast Cancer and Poor Clinical Outcome. Medical Science Monitor : International Medical Journal of Experimental and Clinical Research, 24, 8239-8249.
+ Open protocol
+ Expand
2

Wnt/β-Catenin Pathway Regulation in Rat AECII Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
The following were obtained: sheep anti-rabbit horseradish peroxidase (HRP)-conjugated secondary antibody and RIPA lysis buffer (Cell Signaling Technology, MA, USA); BCA protein and, StarSignal chemiluminescent assay kits (Vazyme, Nanjing, China); StarScript II First-strand cDNA Synthesis Mix with gDNA Remover, 2 × RealStar Green Fast Mixture (with ROXII), and TRIGene (TaKaRa, Dalian, China); polyvinylidene difluoride (PVDF) membranes (Millipore, Burlington, USA); GSK3β, p-GSK3β, cyclin D1, Dvl-1, and β-catenin primary antibodies (ZENBIO Biotech, Chengdu, China); GAPDH primary antibody (Goodhere Biotech, Hangzhou, China); PCR primers (Genscript Biotech, Nanjing, China); MDA and SOD assay kits (Solarbio Life Sciences, Beijing, China); immunohistochemistry kit (MXB, Fujian, China), rat AECII cells (Bnbio, Beijing, China); Roswell Park Memorial Institute (RPMI) 1640, trypsin, penicillin, and streptomycin (Gibco, Thermo Fisher Scientific Inc., USA); fetal bovine serum (Biological Industries, Beth Haemek, Israel); lipofectamine 3000 (Invitrogen, Thermo Fisher, USA); AnnexinV-fluorescein isothiocyanate (FITC)/propidium iodide (PI) apoptosis detection kit and Cell Counting Kit-8 (Vazyme, Nanjing, China); and MSAB (Wnt/β-catenin pathway inhibitor (Selleck, Shanghai, China).
Zhu Y., Li Y., Jin W., Li Z., Zhang L., Fang Y, & Zhang Y. (2023). Hyperoxia exposure upregulates Dvl-1 and activates Wnt/β-catenin signaling pathway in newborn rat lung. BMC Molecular and Cell Biology, 24, 4.
+ Open protocol
+ Expand
3

Quantifying Cardiac Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA from myocardial tissues and H9c2 cells was isolated with TRIzol reagent (Tiangen, Beijing, China) and converted into cDNA using reverse transcriptase
(Tiangen, Beijing, China). The relative expression levels of miR-145-5p, NOH-1, TNF-α, IL-1β, and IL-6 were determined using a SYBR Green-based qRT-PCR assay
(Solarbio) with the relevant primers. Expression of 5S or glyceraldehyde-3-phosphate dehydrogenase (GAPDH) served as the internal reference. The sequences of
all the PCR primers (GenScript, Nanjing, China) were as follows: 5’- GTCCAGTTTTCCCAGGAATCC -3’ (forward) and 5’- GCAGGGTCCGAGGTATTC -3’ (reverse) for
miR-145-5p, 5’- GATCTCGGAAGCTAAGCAGG -3’ (forward) and 5’- TGGTGCAGGGTCCGAGGTAT -3’ (reverse) for 5S, 5’- TTTCCTAAACTACCGACTCTTCC -3’ (forward) and 5’-
TTGTCCCACATTGGTCTCCC -3’ (reverse) for NOH-1, 5’- CGGAAAGCATGATCCGAGAT -3’ (forward) and 5’- AGACAGAAGAGCGTGGTGGC -3’ (reverse) for TNF-α, 5’-
TTCAAATCTCACAGCAGCAT -3’ (forward) and 5’- CACGGGCAAGACATAGGTAG -3’ (reverse) for IL-1β, 5’- AACTCCATCTGCCCTTCA -3’ (forward) and 5’- CTGTTGTGGGTGGTATCCTC -3’
(reverse) for IL-6, and 5’- CGGCAAGTTCAACGGCACAG -3’ (forward) and 5’- CGCCAGTAGACTCCACGACAT -3’ (reverse) for GAPDH.
Tan L., Liu L., Yao J, & Piao C. (2021). miR-145-5p attenuates inflammatory response and apoptosis in myocardial ischemia-reperfusion injury by inhibiting (NADPH) oxidase homolog 1. Experimental Animals, 70(3), 311-321.
+ Open protocol
+ Expand
4

Quantitative Analysis of RNA Biomarkers

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was extracted from cell or tissue samples by Trizol (Invitrogen™). Exosomal RNA was extracted with a kit (Norgen BioTek, NGB-58000). The first strand cDNA synthesis reaction system was prepared in RNase free PCR tube, and theEasyScript first strand cDNA synthesis Supermix k it is used to reverse transcribe RNA into cDNA. SYBR Green qPCR Supermix and Applied Biosystems® 7500 sequence detection system was used to detect the RNA level. GAPDH was used as the internal reference of XIST, and U6 was used as the internal reference of miRNA. PCR primers were purchased from genscript Biotechnology Co., Ltd. The primer sequences were: XIST forward 5’-ACGCTGCATGTGTCCTTAG-3’ and reverse 5’-GAGCCTCTTATAGCTGTTTG-3’; GAPDH forward 5’-TCAAGAAGGTGGTGAAGCAGG-3’ and reverse 5’-TCAAAGGTGGAGGAGTGGGT-3’; miR-655 forward 5’-TGCGCATAATACATGGTTAACC-3’; miR-374c forward 5’-TGCGCATAATACAACCTGCTAA-3’; miR-5590 forward 5’-TGCGCAATAAAGTTCATGTAT-3’; miR-129-1 forward 5’-TGCGCAAGCCCTTACCCCAAAA-3’; miR-129-2 forward 5’-TGCGCAAGCCCTTACCCCAAA-3’; reverse 5’-CCAGTGCAGGGTCCGAGGTATT-3’;U6 forward 5’-CGCTTCGGCAGCACATATAC-3’ and reverse 5’-AAATATGGAACGCTTCACGA-3’. Relative expression was calculated using the 2−△△CT method.
Zhu G., Xia Y., Zhao Z., Li A., Li H, & Xiao T. (2022). LncRNA XIST from the bone marrow mesenchymal stem cell derived exosome promotes osteosarcoma growth and metastasis through miR-655/ACLY signal. Cancer Cell International, 22, 330.
+ Open protocol
+ Expand
5

Molecular Analysis of Cardiac Biomarkers

Check if the same lab product or an alternative is used in the 5 most similar protocols
The equipment used in this study included an Olympus BX51 light microscope (Olympus Corporation, Tokyo, Japan); complete Freund’s adjuvant (Sigma-Aldrich, St. Louis MO, USA); reverse transcription kit (K1699) (Thermo Fisher Scientific, Waltham, MA, USA); a fluorescence-based quantitative polymerase chain reaction (PCR) kit (RR420A) (TaKara, Tokyo, Japan); PCR primers (GenScript, Nanjing, China); anti-BNP antibody (ab19645) (Abcam, Cambridge, UK); anti-NPR-A antibody (GTX109810) (Genetex, Irvine, CA, USA); anti-GAPDH antibody (ab9485) (Abcam, Cambridge, UK); secondary antibody (ab6789) (Abcam, Cambridge, UK); ECL kit (34094) (Thermo Fisher Scientific, Waltham, MA, USA). Other reagents used were obtained locally and were of pure analytical grade.
Yang X., Chen Q., Ma M., Xie W., Gong B., Huang Y., Li Y., Liu S., Hu J., Liang S., Chen J., Liu F, & Sun T. (2019). Expression and Regulation of Brain Natriuretic Peptide and Natriuretic Peptide Receptor A (NPR-A) in L6–S1 Dorsal Root Ganglia in a Rat Model of Chronic Nonbacterial Prostatitis. Medical Science Monitor : International Medical Journal of Experimental and Clinical Research, 25, 9042-9047.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!