Exonuclease 1

After stimulation, macrophage cells were lysed in Qiazol (Qiagen) and stored at −80 until RNA isolation. RNA isolation was performed using Direct-zol 96-well isolation column plates (Zymo Research). Approximately 10 ng of RNA was reverse transcribed using Superscript VILO cDNA synthesis system (Invitrogen). 1.25 uL of cDNA was combined with 0.5 uL of a pool of 96 primer sets (Deltagene assays, Fluidigm) at 500nM concentration each, 2.5 uL 2× Taqman Preamp Master Mix (Applied Biosystems), and made up to 5 uL total volume per reaction with water, in a low-profile 96-well PCR plate (Bio-rad). Specific Target Amplification was run on a CFX Connect thermal cycler (Bio-rad). Following pre-amplification, unincorporated primers were digested by the addition of Exonuclease 1 (New England Biolabs). Samples were analyzed by qPCR on the Fluidigm Biomark instrument using 96.96 chips according to manufacturer’s instructions (Fluidigm). Data were exported from Fluidigm Real-time PCR Analysis software version 3.1.3, using Linear (Derivative) Baseline method, a global threshold of 0.01, and a 0.65 quality threshold, parameters which were found to exclude non-specific amplification and reduce plate-plate variation.

For gene expression analyses, pools of 100 cells were sorted into wells of a DNase and RNase-free 96-well plate (Applied Biosystems) containing 5 μl CellsDirect 2x reaction buffer (Invitrogen), centrifuged for 5 minutes at 500×g, snap-frozen on dry ice and stored at −80°C until use. RNA was reverse-transcribed using Superscript III Taq polymerase (Invitrogen) and preamplified for 18 rounds with a custom 96-target DeltaGene (Fluidigm) primer panel on a PCR cycler (Eppendorf). Excess primers were removed from the preamplified product by incubating with Exonuclease-1 (New England Biolabs), and cDNA samples were diluted in DNA buffer. Primers and cDNAs mixed with SsoFast Sybr Green Master Mix (BioRad) were subsequently loaded onto a Fluidigm 96.96 Dynamic Array IFC and run on a BioMark HD system (Fluidigm). Data were subsequently analyzed using Fluidigm Gene Expression Software and normalized to Gusb. Relative changes were subsequently calculated using ΔΔCt approach. Unsupervised clustering of Gusb-normalized delta CT values with Gusb removed along with poorly performing Ebf1 and Hoxa2 primer sets, was performed using average linkage. Clustering and principal component analysis (PCA), and heatmap generation, were performed using ClustVis software (biit.cs.ut.ee/clustvis). PCA and PCA loading plots were generated using Prism 8 (Graphpad) from data generated by ClustVis.

Splenocytes were stained and sorted using a FACSAria II (Becton Dickinson), dividing B220⁺/CD21^lo/CD23⁺/NP⁺ cells into Igλ1⁺ and Igλ1⁻ populations. RNA was isolated via Trizol (Life technologies)/chloroform phase separation. cDNA was generated using a Onestep RT PCR kit (Qiagen), with nested PCR primers to amplify light chain sequences (Primers: VL1/2: ctgctaccggttcctgggcccaggctgttgtgactcag; VL3: ctgctaccggttcctgggcccaacttgtgctcactcag; JL1: ttgggctggccaaggacagtcagtttggttcc; JL2: ttgggctggccaaggacagtgaccttggttcc; JL3: ttgggctggccaaggacagtcaatctggttcc). cDNA was gel-purified and inserted into the PCR-2.1 Topo vector (Topo-TA kit, Invitrogen), and transformed into Top10 competent E. coli (Invitrogen) via heat shock. Colonies were picked and PCR amplified using M13 primers from the Topo-TA kit. Amplified DNA was treated with recombinant Shrimp Alkaline Phosphatase and Exonuclease 1 (New England Biolabs), and sent to ELIM Biopharm for sequencing. The returned sequences were uploaded to IMGT_V-QUEST (http://www.imgt.org/IMGT_vquest/vquest) for VJ alignment and light chain identification (see Supplemental Table 1).