The glioma cell line U373 and B cell leukemia cell line BV173 were purchased from the American Type Tissue Collection (ATCC) and the German Collection of Microorganisms and Cell Cultures, respectively. The metastatic osteosarcoma cell line LM7 was provided by Eugenie Kleinerman (MD Anderson Cancer Center, Houston, Texas, USA) in 2011. The generation of LM7.eGFP.ffLuc was previously described (12 (link)). U373 EphA2 KO cells were generated using CRISPR/Cas9. A guide RNA targeting the sequence GGGGGGCCGCTCACCCGCAA was selected using the online CRISPRscan scoring algorithm (48 (link)) to maximize cutting efficiency and minimize off-target effects. sgRNA was generated using the HiScribe T7 In Vitro Transcription Kit (New England Biolabs). U373 cells were electroporated with 1 μg Cas9 with NLS (PNA Bio) and 1 μg sgRNA using a Neon Transfection System (Thermo Fisher Scientific). All cell lines were grown in DMEM or RPMI (Cytiva) supplemented with 10% fetal bovine serum (FBS; Cytiva) and 2 mM Glutamax (Invitrogen, Thermo Fisher Scientific). Cell lines were authenticated using the ATCC’s human STR profiling cell authentication service.
Hiscribe t7 in vitro transcription kit
Manufactured by New England Biolabs
Sourced in United States
The HiScribe T7 In Vitro Transcription Kit is a laboratory tool designed to facilitate the production of RNA transcripts from DNA templates in vitro. The kit provides the necessary components, including the T7 RNA polymerase enzyme, nucleotides, and buffer solutions, to enable efficient and reliable in vitro transcription reactions.
Automatically generated - may contain errors
Lab products found in correlation
Megaclear transcription clean up kit, by Thermo Fisher Scientific (3 mentions)
N6 meatp, by TriLink (2 mentions)
Agarose e gel, by Thermo Fisher Scientific (2 mentions)
Protease inhibitor cocktail, by Roche (2 mentions)
Nanodrop 1000 spectrophotometer, by Thermo Fisher Scientific (2 mentions)
Nanodrop 2000 spectrophotometer, by Thermo Fisher Scientific (2 mentions)
Glutamax, by Thermo Fisher Scientific (1 mentions)
Neon transfection system, by Thermo Fisher Scientific (1 mentions)
Dulbecco modified eagle medium (dmem), by Cytiva (1 mentions)
Roswell park memorial institute (rpmi), by Cytiva (1 mentions)
Phusion high fidelity dna polymerase, by Thermo Fisher Scientific (1 mentions)
Rna clean concentrator kit, by Zymo Research (1 mentions)
Rnase free dnase set, by Qiagen (1 mentions)
Cas9 protein, by PNA Bio (1 mentions)
Hybond n membrane, by GE Healthcare (1 mentions)
Dig rna labeling mix, by Roche (1 mentions)
Dig northern starter kit, by Roche (1 mentions)
Dnase 1, by Qiagen (1 mentions)
Pb buffer, by Qiagen (1 mentions)
Cutsmart buffer, by New England Biolabs (1 mentions)
30 protocols using hiscribe t7 in vitro transcription kit
1
Generation and Characterization of Genetically Modified Cell Lines
2
Synthesis of Labeled and Unlabeled PFLU3655 RNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
3′-Biotin-TEG-labeled HPLC-purified 66-nt-long oligonucleotides corresponding to the wild-type 5′-region of PFLU3655 (from nucleotide position −19 to +47: 5′-AUGCCGGAAAAGGGAGUAGGUGAUGCAUUUUUCCAACGUCCUCGCUAUUGCACGGACUCAAUCGAA-BIOTEG-3′) and the double mutant containing the G-8A and A33T substitutions (5′-AUGCCGGAAAAAGGAGUAGGUGAUGCAUUUUUCCAACGUCCUCGCUAUUGCUCGGACUCAAUCGAA-BIOTEG-3′), were commercially prepared (Eurofins). An unlabeled version of the wild-type oligo was generated by in vitro transcription using the HiScribe T7 In Vitro Transcription Kit (NEB) following the manufacturer’s instructions for reactions with short RNA transcripts. The template was prepared by PCR amplification of the 66-nt wild-type sequence from SBW25 genomic DNA using Phusion High-Fidelity DNA polymerase (Thermo Scientific) and primers DWR100/101, incorporating the T7 promoter sequence to the 5′-end of the PCR product. RNA was transcribed from 10 μl unpurified PCR product during a 16-h incubation at 37 °C and purified using the RNA Clean & Concentrator Kit (Zymo Research) including an on-column DNase treatment using RNase-free DNase Set (Qiagen). RNA was quantified using a NanoDrop 1000 Spectrophotometer (Thermo Scientific) and the correct size was confirmed by polyacrylamide gel electrophoresis compared with the commercially prepared oligos.
3
In vitro RNA Synthesis with m6A
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was synthesized using the HiScribe T7 in vitro transcription kit (New England Biolabs). 1 μg of purified PCR product was used for each reaction. Transcription was carried out overnight at 42°C using either ATP or N6-meATP (Trilink). For experiments using varying amounts of m6A within an RNA, transcripts synthesized using all ATP or all N6-meATP were mixed in the indicated proportions.
4
AMPK Gene Silencing in A. aegypti Microbiota
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The role of the AMPK gene in the control of A. aegypti midgut microbiota was assessed using RNA interference-mediated gene silencing, as described previously [26 (link)]. In brief, dsRNAs were constructed using in-vitro transcription with the HiScribe T7 In Vitro Transcription Kit (New England Biolabs). Approximately 207 ng of dsRNA was injected into the thorax of 60 cold-anesthetised 2- to 3-day-old female mosquitoes using a nano-injector. The gene silencing efficiency, evaluated using qPCR, was determined by comparison with an unrelated dsRNA-injected group (Escherichia coli gene MalE) 3 days after the dsRNA injection. Typically, 10 mosquitoes were analysed per experiment in each group.
5
CRISPR-Cas9 Murine and Human AML Editing
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
sgRNA against murine Rosa26 (negative control) and Nmnat1 as well as human ENAM (negative control) and NMNAT1 were designed according to CRISPR DESIGN (http://crispr.mit.edu/ ). We cloned sgRNA with a T7 promoter sequence and transcribed using the HiScribe T7 In Vitro Transcription Kit (NEB, Ipswich, MA). We introduced the Cas9-sgRNA complex to murine AML cells as previously described (38 (link), 53 (link)). In brief, 1 μg of Cas9 protein (PNA Bio, Newbury Park, CA) was incubated with 1 μg of in vitro–transcribed sgRNA at room temperature for 5 min before being electroporated for murine AML cells (105 cells per reaction) using the Neon Transfection System (MPK1096, Thermo Fisher Scientific) using the following parameters: 1700 V, 20 ms, and 1 pulse. Human AML cells were electroporated with the following parameters: 1350 V, 20 ms, and 1 pulse. Cells were then cultured for at least 12 hours before subsequent assays including transplantation, cell counting, and immunoblotting.
6
Comprehensive Northern Blot Analysis Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Northern blot (NB) analysis was performed according to the manufacturer’s instructions (DIG Northern Starter Kit, Roche). Digoxigenin (DIG)-labeled riboprobes were transcribed by DIG RNA labeling Mix (Roche, USA) and the HiScribe T7 In Vitro Transcription Kit (NEB, USA), and then purified by phenol-chloroform extraction and ethanol precipitation. Ten micrograms of total RNA or 1 mg of in vitro synthesized linear or circRNA was electrophoresed on a denaturing urea polyacrylamide gel, transferred to a Hybond-N+ membrane (GE, USA) by a positive capillary transfer system and UV-crosslinked as a standard protocol. The membrane was then hybridized with specific DIG-labeled riboRNA probes. NB probes are listed in Table S2 .
7
Transcription Protocol using pGE-TaGW2 and pGE-TaGASR7
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The templates for transcription were amplified from pGE-TaGW2 or pGE-TaGASR7 using appropriate primers (Supplementary Table 3 ). Transcription was accomplished using the HiScribe T7 In Vitro Transcription Kit (New England Biolabs) according to the manufacturer's instructions.
8
In Vitro Cas9 Cleavage Assay
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Cas9 orthologs were human codon-optimized and synthesized by GenScript, and transfected into 293FT cells as described below. Whole cell lysates from 293FT cells were prepared with lysis buffer (20 mM HEPES, 100 mM KCl, 5 mM MgCl2, 1 mM DTT, 5% glycerol, 0.1% Triton X-100) supplemented with Protease Inhibitor Cocktail (Roche). T7-driven sgRNA was transcribed in vitro using custom oligos (Supplementary Information ) and HiScribe T7 In vitro Transcription Kit (NEB), following the manufacturer’s recommended protocol. The in vitro cleavage assay was carried out as follows: for a 20 μl cleavage reaction, 10 μl of cell lysate was incubated with 2 μl cleavage buffer (100 mM HEPES, 500 mM KCl, 25 mM MgCl2, 5 mM DTT, 25% glycerol), 1 μg in vitro transcribed RNA and 200 ng EcoRI-linearized pUC19 plasmid DNA or 200 ng purified PCR amplicons from mammalian genomic DNA containing target sequence. After 30 min incubation, cleavage reactions were purified using QiaQuick Spin Columns and treated with RNase A at final concentration of 80 ng/μl for 30 min and analyzed on a 1% Agarose E-Gel (Life Technologies).
9
Deoptimized DENV2 Virus Generation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Wild-type DENV2 virus was designed based on strain 16681 genome (Accession # U87411) and divided into four fragments incorporating 26 silent mutations as described previously [17 (link)]. CP-deoptimized viruses were recovered from transfection of C6/36 cells with capped RNA transcribed using HiScribe T7 in vitro transcription kit (New England Biolabs). Virus stocks were grown in C6/36 cells by harvesting cell culture supernatant 6 days post-infection at an MOI of 0.1. Viruses were titrated in C6/36 cells using a focus forming assay [17 (link)].
10
In vitro RNA Synthesis with m6A
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!