Rnu6b

Manufactured by Thermo Fisher Scientific

Sourced in United States

RNU6B is a small nuclear RNA that serves as a common internal control in quantitative PCR (qPCR) experiments. It is a component of the small nuclear ribonucleoprotein (snRNP) complex and is involved in the splicing of pre-mRNA. RNU6B is often used as a reference gene for normalization in gene expression studies due to its stable expression across a wide range of cell and tissue types.

Automatically generated - may contain errors

Lab products found in correlation

78 protocols using rnu6b

Quantification of miRNA Expression Levels

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

The expression levels of miRNAs were determined as described previously [28 ,31 (link)]. In brief, total RNA, including small RNA, was extracted and purified using the miRNeasy^® Mini Kit (QIAGEN Inc.). TaqMan^® MicroRNA Reverse Transcription Kit (Applied Biosystems) was used to generate cDNA with the primers specific to the mature miRNA. The expression levels of miR-203, miR-542-3p, Let-7c, and miR-29b were then measured by qRT-PCR using TaqMan Assays (Assay ID: 000507, 001284, 000379, 000413, respectively; Applied Biosystems). RNU6B (Assay ID: 001093; Applied Biosystems) was used as an internal control. The relative miRNA levels were calculated by the comparative Ct method (ΔΔCt).

Lyu H., Wang S., Huang J., Wang B., He Z, & Liu B. (2018). Survivin-targeting miR-542-3p overcomes HER3 signaling-induced chemoresistance and enhances the antitumor activity of paclitaxel against HER2-overexpressing breast cancer. Cancer letters, 420, 97-108.

+ Open protocol

+ Expand

Quantification of miR-122 and its precursor

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was isolated by using TRIzol (Life Technologies, # 15596018) and purified following DNase I digestion. DNA-free RNA was reverse-transcribed into complementary DNA (cDNA) using a high-capacity cDNA reverse transcription kit (Applied Biosystem, # 4368813). RT-qPCR analysis of each sample was performed in triplicate using the SYBR Green method. Relative gene expression was calculated using the delta-delta-CT (ΔΔCT) method with the level of ACTB gene as the normalizer. Primer sequences are provided in Supplementary Table S1. To detect the primary transcripts and mature miR-122, TaqMan assays were used (Applied Biosystems, #Hs03303072 for primary miR-122; #TM: 002245 for mature miR-122). The expression of the primary and mature miR-122 transcripts was calculated by ΔΔCT method using RNU6B (Applied Biosystems, #TM: 001093) as the normalizer.

Teng K.Y., Barajas J.M., Hu P., Jacob S.T, & Ghoshal K. (2020). Role of B Cell Lymphoma 2 in the Regulation of Liver Fibrosis in miR-122 Knockout Mice. Biology, 9(7), 157.

+ Open protocol

+ Expand

Quantitative Analysis of miRNA Expression

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was isolated from tissues or cells using TRIzol (Invitrogen) and reverse-transcribed into cDNA using ReverTraAce-alpha (TOYOBO, Osaka, Japan) as described previously [20 (link)]. To assess miRNA expression levels, total RNA was reverse-transcribed using a miR-222 or 221-specific stem-loop primer (Assay ID: 002276, 000524, Applied Biosystems, Waltham, MA, USA) and the TaqMan MicroRNA Reverse Transcription Kit (Applied Biosystems). Quantitative real-time PCR (qRT-PCR) was performed using the LightCycler System (Roche Molecular Biochemicals, Mannheim, Germany) with TaqMan Universal PCR Master Mix II (Applied Biosystems). mRNA, miR-222 and miR-221 transcriptional levels were normalized to 18S, snoRNA202 (Assay ID: 001232, Applied Biosystems) for mice and RNU6B (Assay ID:001093, Applied Biosystems) for human, respectively. Primer sequences used for qRT-PCR are listed in S1 Table.

Ono K., Igata M., Kondo T., Kitano S., Takaki Y., Hanatani S., Sakaguchi M., Goto R., Senokuchi T., Kawashima J., Furukawa N., Motoshima H, & Araki E. (2018). Identification of microRNA that represses IRS-1 expression in liver. PLoS ONE, 13(1), e0191553.

+ Open protocol

+ Expand

Quantification of RNA Transcripts

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted using miRNeasy Micro Kit (Qiagen Inc.) or TRIzol (Invitrogen) and reverse transcribed using a standard cDNA synthesis or the TaqMan MicroRNA Reverse Transcription Kit with mouse and/or human-specific sets of primers/probe for BCR-ABL1, CEBPB, FOXM1, TUG1, IFNγ, pri-MIR300, MIR300, pre-miR-155 (BIC), 18S, RNU44, RNU6B, and snoRNA202 (Applied Biosystems). PCR reactions were performed using a StepOnePlus Real Time PCR System (Applied Biosystems). Data were analyzed according to the comparative C_t method using RNU44, RNU6B, 18S, and snoRNA202 transcripts as an internal control. Results are expressed as fold change of mean ± SEM.

Silvestri G., Trotta R., Stramucci L., Ellis J.J., Harb J.G., Neviani P., Wang S., Eisfeld A.K., Walker C.J., Zhang B., Srutova K., Gambacorti-Passerini C., Pineda G., Jamieson C.H., Stagno F., Vigneri P., Nteliopoulos G., May P.C., Reid A.G., Garzon R., Roy D.C., Moutuou M.M., Guimond M., Hokland P., Deininger M.W., Fitzgerald G., Harman C., Dazzi F., Milojkovic D., Apperley J.F., Marcucci G., Qi J., Polakova K.M., Zou Y., Fan X., Baer M.R., Calabretta B, & Perrotti D. (2020). Persistence of Drug-Resistant Leukemic Stem Cells and Impaired NK Cell Immunity in CML Patients Depend on MIR300 Antiproliferative and PP2A-Activating Functions. Blood Cancer Discovery, 1(1), 48-67.

+ Open protocol

+ Expand

Quantifying miR-146a Expression in FFPE Tumor Samples

Cited 2 times

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA including miRNA was extracted from tumor sections using the miRNeasy FFPE Kit (QIAGEN, KJ Venlo, the Netherlands) according to our previous reports (32-34 (link)). RNA concentrations were determined by NanoDrop 2000 (Wilmington, DE, USA). A combination of RUN6B and RUN48 was the housekeeping genes for detection of miR-146a expression (33,34 (link)). The primers for miR-146a, RNU6B and RNU48, were included in TaqMan® MicroRNA Assays (4427975, Applied Biosystems, Life Technologies, Grand Island, NY, USA). Sequence of miRNA and references used in the paper are as follows: miR-146a (Applied Biosystems Cat. No. 4427975-000468): UGAGAACUGAAUUCCAUGGGUU; RNU6B (Applied Biosystems Cat. No. 4427975-001093): CGCAAGGAUGACACGCAAAUUCGUGAAGCGUUCCAUAUUUUU; RNU48 (Applied Biosystems Cat. No. 4427975-001006): GAUGACCCCAGGUAACUCUGAGUGUGUCGCUGAUGCCAUCACCGCAGCGCUCUGACC. The reverse primers were also used for reverse transcription with TaqMan® MicroRNA Reverse Transcription Kit (4366596, Applied Biosystems, Life Technologies, Grand Island, NY, USA) in a total volume of 10 μL. Real-time qPCR for miRNA was performed with Applied Biosystems PCR7900. The miR-146a abundance in each sample was normalized to its references. The expression of miR-146a in the FFPE experiments was calculated with the formula 2^-Δcq (32-35 (link)).

Rong M., He R., Dang Y, & Chen G. (2014). Expression and clinicopathological significance of miR-146a in hepatocellular carcinoma tissues. Upsala Journal of Medical Sciences, 119(1), 19-24.

+ Open protocol

+ Expand

Profiling mRNA and miRNA Levels

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNAs were extracted with Trizol reagent according to the manufacturer’s instruction (Invitrogen, CA, USA). To determine the mRNA levels of AR, YB-1 and PSA, total RNAs were reversely transcribed by iScript cDNA Synthesis Kit (Bio-Rad Laboratories, Hercules, CA), respectively, according to the manufacturer’s instructions34 (link). The 18 S rRNA gene was used as reference for normalization34 (link). Taqman RT-qPCR was performed to detect mature miRNA expression using Taqman miRNA reverse transcription kit, has-miR-190a (AB Assay ID: 000489) and RNU6B (U6, AB Assay ID: 001093) according to the manufacturer’s protocol (Applied Biosystems)35 (link). The U6 was used as reference for normalization35 (link).

Xu S., Wang T., Song W., Jiang T., Zhang F., Yin Y., Jiang S.W., Wu K., Yu Z., Wang C, & Chen K. (2015). The inhibitory effects of AR/miR-190a/YB-1 negative feedback loop on prostate cancer and underlying mechanism. Scientific Reports, 5, 13528.

+ Open protocol

+ Expand

Quantification of miRNA-29 Family

Check if the same lab product or an alternative is used in the 5 most similar protocols

MicroRNAs were quantified by real time RT-PCR Taqman assays (has-miRNA-29a, has-miRNA-29b, has-miRNA-29c, RNU6B, Applied Biosystems, Monza, Italy). Briefly, miRNAs were extracted from PBMCs, CD4+ T lymphocytes and CD14+ monocytes using the mirVana miRNA Isolation Kit (Ambion, Austin, TX, USA). Cellular miRNA purity was evaluated spectrophotometerically at the absorbance 230, 260 and 280 nm (Varioskan™ Flash Multimode Reader, Thermo Fisher Scientific Waltham, MA, USA). Then, miRNAs were reverse transcripted using TaqMan MicroRNA Reverse Transcription Kit, according to the manufacturer's protocols (Applied Biosystems); real time PCR was carried out in a final volume of 20 μl using LightCycler480 instrument (Roche, Basel, Switzerland). The constitutively expressed RNU6B was used as an internal control. Expression values of miRNA-29s were calculated by the comparative threshold cycle (Ct) method. In particular, the data were analyzed using the equation 2^−deltaC_T, where DeltaC_T = (C_T of target miRNA − C_T of internal control).

Monteleone K., Selvaggi C., Cacciotti G., Falasca F., Mezzaroma I., D’Ettorre G., Turriziani O., Vullo V., Antonelli G, & Scagnolari C. (2015). MicroRNA-29 family expression and its relation to antiviral immune response and viro-immunological markers in HIV-1-infected patients. BMC Infectious Diseases, 15, 51.

+ Open protocol

+ Expand

Quantifying miRNA and mRNA Expressions

Check if the same lab product or an alternative is used in the 5 most similar protocols

mirVana RNA isolation kits were used for extraction of RNA from GC tissues or cultured cells (Invitrogen, Carlsbad, CA, USA). RNAs were maintained at -80° C until used. The expression of miRNAs was analyzed using TaqMan MicroRNA Assays kit (Applied Biosystems, USA) according to the manufacturer’s instruction. RNU6B (Applied Biosystems) served as an endogenous control. PrimeScript^™ RT reagent Kit and SYBR® Green Master Mix (Takara, Dalian) were used to synthesize cDNA and quantify the expression of SUFU. GAPDH served as an endogenous control.

Peng Y., Zhang X., Lin H., Deng S., Qin Y., He J., Hu F., Zhu X., Feng X., Wang J., Wei Y., Fan X., Lin H., Ashktorab H., Smoot D., Lv Y., Li S., Meltzer S.J, & Jin Z. (2021). Dual activation of Hedgehog and Wnt/β-catenin signaling pathway caused by downregulation of SUFU targeted by miRNA-150 in human gastric cancer. Aging (Albany NY), 13(7), 10749-10769.

+ Open protocol

+ Expand

Quantitative Analysis of INTS6, INTS6P1, and miR-17-5p Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

To evaluate the expression level of INTS6, INTS6P1 and miR-17-5p, quantitative real-time PCR (qRT-PCR) was performed. The specific primer sets for INTS6 and INTS6P1 were designed from the regions that share low homology between INTS6 and INTS6P1 (Supporting document 1: Table 2). The specificity of the primers was verified by PCR the relevant genes and sequencing the PCR products (Supporting document 2). TaqMan miR Assay kits (Applied Biosystems) were used for miR-17-5p (Applied biosystems) and normalized to RNU6B (Applied biosystems). Power SYBR Green PCR Master Mix (Applied Biosystems) was used for INTS6P1 and INTS6 qRT-PCR. The expression of INTS6P1 and INTS6 was normalized to GAPDH. Relative expression of target RNAs was calculated using the delta Ct method. All PCR reactions were carried out on the 7900 HT Fast Real-time PCR System (Applied Biosystems) in duplicate.

Peng H., Ishida M., Li L., Saito A., Kamiya A., Hamilton J.P., Fu R., Olaru A.V., An F., Popescu I., Iacob R., Dima S., Alexandrescu S.T., Grigorie R., Nastase A., Berindan-Neagoe I., Tomuleasa C., Graur F., Zaharia F., Torbenson M.S., Mezey E., Lu M, & Selaru F.M. (2015). Pseudogene INTS6P1 regulates its cognate gene INTS6 through competitive binding of miR-17-5p in hepatocellular carcinoma. Oncotarget, 6(8), 5666-5677.

+ Open protocol

+ Expand

Quantification of miRNA Expression Levels

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!