Pam3CSK4 was purchased from InvivoGen Co. (San Diego, CA). The anti-human Mac-1 antibody (cat no. 16-0113) and anti-mouse IgG isotype control antibody (cat no. 16-4714) were purchased from eBioscience (San Diego, CA). The R-phycoerythrin (PE)-conjugated mouse anti-human Mac-1 (clone ICRF44; BD) antibody (cat no. 555388) and PE-conjugated mouse IgG isotype control (clone MOPC-21) antibody (cat no. 555749) were obtained from BD (San Diego, CA). Calcein AM (an acetomethoxy (AM) derivative of calcein) and luciferase reporter constructs containing NF-κB (cat no. 219078) and CREB (cat no. 219076) consensus-binding sites were purchased from Agilent Technologies (Santa Clara, CA, USA). The anti-SIRT1 antibody and horseradish peroxidase (HRP)-conjugated IgG (secondary antibody) were obtained from Santa Cruz Biotechnology Inc. (Beverly, MA). ImProm-II Reverse Transcription Kits were supplied by the Promega Corporation (Madison, WI). DNeasy Tissue Kits and QIAprep Spin Kits were purchased from Qiagen (GmbH, Germany).
Qiaprep spin kit
Manufactured by Qiagen
Sourced in Germany
The QIAprep Spin kit is a DNA plasmid purification system designed for rapid and efficient isolation of high-quality plasmid DNA from bacterial cultures. The kit utilizes a silica-membrane-based spin column technology to capture and purify plasmid DNA, which can then be eluted for further downstream applications.
Automatically generated - may contain errors
Lab products found in correlation
Dneasy tissue kit, by Qiagen (3 mentions)
Dual luciferase reporter assay system, by Promega (2 mentions)
Pgl3 basic, by Promega (2 mentions)
Quickchange mutagenesis, by Agilent Technologies (2 mentions)
Qubit dsdna hs assay kit, by Thermo Fisher Scientific (2 mentions)
T4 dna ligase, by Thermo Fisher Scientific (2 mentions)
Anti sirt1 antibody, by Santa Cruz Biotechnology (1 mentions)
Horseradish peroxidase hrp conjugated igg secondary antibody, by Santa Cruz Biotechnology (1 mentions)
Anti human mac 1 antibody, by Thermo Fisher Scientific (1 mentions)
Anti mouse igg isotype control antibody, by Thermo Fisher Scientific (1 mentions)
R phycoerythrin pe conjugated mouse anti human mac 1 clone icrf44 antibody, by BD (1 mentions)
Pe conjugated mouse igg isotype control clone mopc 21 antibody, by BD (1 mentions)
Pam3csk4, by InvivoGen (1 mentions)
Prl cmv vector, by Promega (1 mentions)
Dual luciferase reporter assay kit, by Promega (1 mentions)
Horseradish peroxidase hrp conjugated igg, by Santa Cruz Biotechnology (1 mentions)
Lps from escherichia coli, by Merck Group (1 mentions)
Purified anti human tlr4 antibody, by Thermo Fisher Scientific (1 mentions)
Pgl3 basic vector, by Promega (1 mentions)
Nanodrop 1000 spectrophotometer, by Thermo Fisher Scientific (1 mentions)
21 protocols using qiaprep spin kit
1
Molecular Mechanisms of Macrophage Activation
2
Escherichia coli LPS Signaling Pathway
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
LPS from Escherichia coli was purchased from Sigma-Aldrich (Saint Louis, MO). pGL3 basic vector, pRL CMV vector, and dual luciferase reporter assay kits were purchased from Promega (Madison, WI). DNeasy Tissue Kits and QIAprep Spin Kits were supplied by Qiagen (GmhH, Germany). The various signal pathway inhibitors used were acquired from Calbiochem (Ra Jolla, CA) and Sigma (St. Louis, MO). 5-LO antibody were purchased from Santa Cruz Biotechnology (Beverly, MA). Akt, phosphospecific antibody against Akt and IKK were from Cell Signaling Technology (Beverly, MA). Purified anti-human TLR4 antibody was from eBioscience (San Diego, CA). Horseradish peroxidase (HRP)-conjugated IgG (Santa Cruz Biotechnology, Santa Cruz, MA) was used as the secondary antibody.
3
Genomic DNA Extraction and Plasmid Preparation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Genomic DNA was extracted from N. meningitidis using the DNeasy Tissue kit (Qiagen, Manchester, UK). Plasmid DNA was prepared by using the QIAprep Spin kit (Qiagen). DNA was quantified using a NanoDrop 1000 Spectrophotometer (NanoDrop Technologies, Wilmington, Delaware, USA). Restriction enzymes were purchased from New England Biolabs. All enzymatic reactions were carried out according to the manufacturer's instructions. A Rapid DNA Ligation kit (Fermentas Life Sciences, Vilnius, Lithuania) was used for ligation reactions. DNA sequencing was carried out by Source Bioscience, UK.
4
Promoter-Driven Luciferase Assay
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
A series of constructs of OPN promoter in luciferase expression vector pGL3-basic (Promega) were prepared. The OPN promoter was amplified from genomic DNA using the following PCR primers (forward 5'-AGTGTAGGAAGCAGTCAGTCCTGTCAG-3' ; reverse 5'-TACCTTGGCTGGCTTCTCGAGCATGCT-3' ), and then cloned into pGL3-basic to generate a pLuc-OPN-2284 construct. Additional deletion constructs lacking distal promoter sequences (denoted pLuc-OPN-538 and pLuc-OPN-234) were prepared by digesting pLuc-OPN-2284 with restriction enzymes (NheI, Sac1 or Xho1).
All plasmids were prepared using the QIAprep spin kit (Qiagen Inc., Hilden, Germany). Cells were transfected with plasmids using Lipofectamin 2000 Transfection Reagent (Zymed Laboratories; Invitrogen), according to the manufacturer's instructions. Cell lysates were prepared using the passive lysis buffer from the Promega assay system (Promega, Madison, WI) and luciferase activity was determined using the dual luciferase reporter assay system (Promega).
All plasmids were prepared using the QIAprep spin kit (Qiagen Inc., Hilden, Germany). Cells were transfected with plasmids using Lipofectamin 2000 Transfection Reagent (Zymed Laboratories; Invitrogen), according to the manufacturer's instructions. Cell lysates were prepared using the passive lysis buffer from the Promega assay system (Promega, Madison, WI) and luciferase activity was determined using the dual luciferase reporter assay system (Promega).
5
Plasmid and Genomic DNA Extraction and Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Genomic DNA was extracted from N. meningitidis using the Gentra Puregene Yeast/Bact Kit (Qiagen) and plasmid DNA was extracted from E. coli using the QiaPrep Spin kit (Qiagen). DNA samples were analyzed by agarose gel electrophoresis and visualized by staining with SYBR Safe (Invitrogen). Restriction enzymes (NEB), T4 DNA ligase (Promega), and Antarctic Phosphatase (NEB) were used according to the manufacturer’s recommendations. PCRs were performed using Q5 polymerase kit (NEB) in a Perkin- MJ Research PTC-200 Peltier Thermal Cycler or C1000 TouchTM Thermal Cycler (Bio-Rad). Primers were purchased from Sigma and their sequences listed in Table 3 . PCR products and restriction digested DNA were purified using the PCR Mini Elute kit (Qiagen). E. coli was transformed by heat shock (Froger and Hall, 2007 (link)).
6
Small-Scale Plasmid Isolation Methods
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Plasmid preparations from small overnight cultures (1–5 ml) were either obtained using the QIAprep spin kit according to supplier’s protocol (Qiagen, Hilden, Germany), especially if the DNA was used for sequencing, or prepared using the rapid boiling miniprep method [16 (link)].
7
Generation of lacO Repeat Plasmids
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
pJD82 (Extended Data 9 ) was created by replacing the SacI-KpnI fragment of pBlueScript II KS- with the sequence:
Extended Data 9 ). Recognition sites for nicking enzymes were introduced by QuickChange mutagenesis (Agilent Technologies, Santa Clara, CA) according to the manufacturer’s guidelines.
To propagate lacO plasmid DNA, plasmids were transformed into DH5α cells and grown for a minimal number of passages in the presence of 2 mM IPTG. DNA was prepared using the QIAprep spin kit (Qiagen, Valencia, CA). To eliminate preparations containing genetic rearrangements (typically ∼25%) each preparation was separated by electrophoresis on a 0.8% agarose gel and visualized by ethidium bromide staining. Preparations that were free of rearranged plasmids were then verified by sequencing (Genewiz, Cambridge, MA).
GAGCTCTCACACCTACAAGGGATGTACATCAATTGTGAGCGGATAACAATTGTTAGGGAGGAATTGTGAGCGGATAACAATTTGGAGTTGATAATTGTGAGCGGATAACAATTGGCTTCAACGTAATTGTGAGCGGATAACAATTTCCGTACGAATGTGCCGAACTTATGGTACC
To propagate lacO plasmid DNA, plasmids were transformed into DH5α cells and grown for a minimal number of passages in the presence of 2 mM IPTG. DNA was prepared using the QIAprep spin kit (Qiagen, Valencia, CA). To eliminate preparations containing genetic rearrangements (typically ∼25%) each preparation was separated by electrophoresis on a 0.8% agarose gel and visualized by ethidium bromide staining. Preparations that were free of rearranged plasmids were then verified by sequencing (Genewiz, Cambridge, MA).
8
Cloning and Sequencing Antibody Variable Regions
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Immunglobulin heavy and light chain variable region (VH-JH, Vκ-Jκ, and Vλ-Jλ) gene PCR products were purified, and then blunt end ligated into pUC18 (SmaI/BAP) plasmid vector (Pharmacia Biotech) before transformation into Escherichia coli TG1 bacteria. Gene-insert positive clones were selected by PCR screen technique (17 ). Sequencing of the plasmid dsDNA minipreps (QIAprep Spin kit; Qiagen) was performed by automatic sequencing (Dye Terminator Sequence Reaction Kit, DyeEx Spin kit (Qiagen; ABI PRISM Software, automatic sequencer of Perkin Elmer, and partly with commercially available sequencing service (Invitrogen, San Diego, CA).
9
Engineered E1 Mutant Construct
10
Fluorescent Sanger Sequencing Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Standard fluorescent Sanger sequencing was performed by Agencourt/Beckman Coulter or Macrogen, using custom or vector primers and plasmid DNA purified with the QIAprep Spin kit (Qiagen). Reads were assembled using MacVector software.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!