Total rna extraction kit

Manufactured by Qiagen

Sourced in Germany, United States, China

The Total RNA Extraction Kit is a laboratory product designed to extract total RNA from a variety of sample types. The kit utilizes a guanidinium thiocyanate-phenol-chloroform extraction method to efficiently isolate high-quality RNA for use in downstream applications.

Automatically generated - may contain errors

Lab products found in correlation

49 protocols using total rna extraction kit

Insect RNA Extraction Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols

Insect pools were transferred into magnalyser green bead tubes (Roche Germany). 1ml of PBS (Gibco) was then added to each tube. Pools were homogenized using a 1.4mm magnalyser ceramic bead by shaking MagNa Lyser (Roche, Germany). Following homogenization, the unsoluable particulates were pelleted by centrifugation at 4 °C, 3000rpm for 15min.
The supernatant from each pool was then transferred into a new tube and used for nucleic acid purification using the total RNA extraction kit (Qiagen, Spain) according to the manucfacturer’s instructions.

Ozan E., Albayrak H., Gumusova S., Bolukbas C.S., Kurt M., Pekmezci G.Z., Beyhan Y.E., Kadi H., Kaya S., Aydin I, & Yazici Z. (2019). A Study on the Identification of Five Arboviruses from Hematophagous Mosquitoes and Midges Captured in Some Parts of Northern Turkey. Journal of Arthropod-Borne Diseases, 13(2), 224-233.

+ Open protocol

+ Expand

Quantification of HBV Transcripts in Liver Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

One μg of total RNA extracted from HepG2 and Huh7.5 cells using total RNA extraction kit (Qiagen, Hilden, Germany) was transcribed into cDNA after DNase digestion using SuperScript II Reverse Transcriptase (Invitrogen, Carlsbad, USA). HBV pgRNA was detected as described [69 (link)]. For gene expression analysis, appropriate exon-exon spanning primer pairs were selected (Supplementary Table 2). To distinguish HBV-genomic-DNA from HBV-plasmid-DNA used for transfections, rcDNA specific primers HBV3054fw 5′-ACTAGGAGGCTGTAGGCATA-3′, HBV132rev 5′-AGACTCTAAGGCTTCCCG-3′ were designed. Real-time PCRs were performed using the LightCycler™ system and normalized to a dilution series of calibrator cDNA using the Relative Quantification Software (both Roche Diagnostics) as described [69 (link)].

von Olshausen G., Quasdorff M., Bester R., Arzberger S., Ko C., van de Klundert M., Zhang K., Odenthal M., Ringelhan M., Niessen C.M, & Protzer U. (2018). Hepatitis B virus promotes β-catenin-signalling and disassembly of adherens junctions in a Src kinase dependent fashion. Oncotarget, 9(74), 33947-33960.

+ Open protocol

+ Expand

MTDN2 Gene Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

After washing dsRNA treated- mites and control with PBS two times, and the total RNA was extracted using total RNA extraction kit (Qiagen, Germany). After assaying the concentrations and purity, RNA were reverse transcribed into cDNAs according to the protocol of RT-PCR kit (Qiagen, Germany). PCR primers of MTDN2 gene for the analysis were forward: 5‘-TCCTCCCTACTCTCCTTCATAATC-3‘, reverse: 5‘-AGGGAAGGTACACCATAGGTAG-3‘.

Shang X.F., Dai L.X., Yang C.J., Guo X., Liu Y.Q., Miao X.L, & Zhang J.Y. (2020). A value-added application of eugenol as acaricidal agent: The mechanism of action and the safety evaluation. Journal of Advanced Research, 34, 149-158.

+ Open protocol

+ Expand

Transcriptome Analysis of P. falciparum Response to DHA

Check if the same lab product or an alternative is used in the 5 most similar protocols

Tightly synchronized ring-stage P. falciparum 3D7 cultures were exposed to DHA at the median inhibitory concentration (IC₅₀, 10 nM) for 24 h until the parasites were grown to late-trophozoite stage. Total RNA was extracted from the trophozoite stage of the parasite using a total RNA extraction kit (Qiagen, Valencia, CA, USA) according to the manufacturer’s instructions. The RNA quantity and integrity were checked using a NanoDrop 2000 spectrophotometer and bioanalyzer 2100 (Agilent Technologies, Santa Clara, CA, USA). A complementary DNA (cDNA) library was constructed using a TruSeq RNA sample preparation kit v2 (Illumina, San Diego, CA, USA). Finally, sequencing libraries were constructed using a NEBNext UltraTM RNA library prep kit for Illumina (NEB, USA) according to the manufacturer’s instructions.

Chen L., Zheng Z., Liu H., Wang X., Qu S., Yang Y., Deng S., Zhang Y., Tuo L., Zhao Y, & Li Y. (2021). Combined Transcriptome and Proteome Profiling for Role of pfEMP1 in Antimalarial Mechanism of Action of Dihydroartemisinin. Microbiology Spectrum, 9(3), e01278-21.

+ Open protocol

+ Expand

Robust RNA Extraction and cDNA Synthesis

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA was extracted from 0.25 ml of fresh blood using a total RNA extraction kit according to the manufacturer's instructions (Qiagen). Then, the concentration and purity of the total RNA were determined using a nucleic acid protein analyzer. Total RNA was used as a template and reverse transcribed using the Prime Script Strand cDNA synthesis kit/reverse transcription (RT) Master Mix, according to the manufacturer's instructions. The reaction system used consisted of the following components: template RNA, 5 µl (≤500 ng); PrimeScript RT enzyme mix, 2 µl; and RNase-free water, 3 µl. The samples were incubated at 37 °C for 15 min and then 85 °C for 5 s.

Liu M., Sun X., Lin L., Luo X., Wang S., Wang C., Zhang Y., Xu Q., Xu W., Wu S., Lan X, & Chen Y. (2022). Clinical characteristics and genetics of ten Chinese children with PRRT2-associated neurological diseases. Frontiers in Pediatrics, 10, 997088.

+ Open protocol

+ Expand

Quantifying lncRNA Expression in Colon Cancer

Check if the same lab product or an alternative is used in the 5 most similar protocols

Eleven pairs of colon cancer and adjacent tissue samples were collected from the Second Affiliated Hospital of Zhejiang University School of Medicine. Total cellular and tissue RNA was extracted using a total RNA extraction kit (73404, Qiagen) according to standard protocol. The RNA was used to synthesize complementary DNA (cDNA) with a cDNA Synthesis SuperMix (11141ES60, Yeasen). The cDNA was used as a template and lncRNA expression was quantified with the Roche LightCycler 480 using SYBR Green Master Mix (11198ES25, Yeasen). β-actin was used as an endogenous control. Primers were synthesized by Sangon Biotech (Sangon, China). The sequences are listed in Table 1.

Xu M., Mu J., Wang J., Zhou Q, & Wang J. (2022). Construction and validation of a cuproptosis-related lncRNA signature as a novel and robust prognostic model for colon adenocarcinoma. Frontiers in Oncology, 12, 961213.

+ Open protocol

+ Expand

Quantitative Real-Time PCR Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

For qRT-PCR, mRNA was isolated using a total RNA extraction kit (Qiagen), and cDNA was produced using a first-strand synthesis kit (Invitrogen). Transcript levels were measured using validated gene-specific primers (Qiagen). Each experiment was carried out at least three times, and representative results (ΔC_t method) are shown. Gapdh was used as the internal control.

Thapa D., Wu K., Stoner M.W., Xie B., Zhang M., Manning J.R., Lu Z., Li J.H., Chen Y., Gucek M., Playford M.P., Mehta N.N., Harmon D., O'Doherty R.M., Jurczak M.J., Sack M.N, & Scott I. (2018). The protein acetylase GCN5L1 modulates hepatic fatty acid oxidation activity via acetylation of the mitochondrial β-oxidation enzyme HADHA. The Journal of Biological Chemistry, 293(46), 17676-17684.

+ Open protocol

+ Expand

Telomerase-Transduced Mouse Mesenchymal Stem Cell Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols

All cell culture reagents and media were purchased from Invitrogen Corp. (Carlsbad, CA) and chemicals were from Sigma-Aldrich Corp. (St. Louis, MO) unless otherwise mentioned. Total RNA extraction kit was from Qiagen Corp. (Valencia, CA) and quantitative real time reverse-transcriptional polymerase chain reaction (qRT-PCR) kits were obtained from Applied Biosystems (Carlsbad, CA). BCA protein assay kit was purchased from Thermo Scientific (Rockford, IL). Transfection agent Fugene HD, hygromycin B, α-MEM, 10% fetal bovine serum (FBS), fungizone and antibiotics were purchased from Invitrogen (Grand Island, NY). Primary antibodies to mouse vimentin, Cartilage Oligomeric Matrix Protein (COMP), and Collagen X were from Abcam Plc. (Cambridge, MA), to mouse fibroblast specific protein 1 (FSP1), aggrecan and β-actin were from Sigma-Aldrich Corp., and to mouse collagen I and collagen II were from EMD Chemicals Inc. (Gibstown, NJ). The pGRN145 plasmid containing a cDNA encoding human telomerase reverse transcriptase (hTERT) was obtained from ATCC (Manassas, VA). C57BL/6J mice were purchased from Jackson Laboratories (Bar Harbor, ME). All animal procedures were conducted in compliance with federal and institutional guidelines and approved by the Institutional Animal Care and Use Committee.

Park Y., Hosomichi J., Ge C., Xu J., Franceschi R, & Kapila S. (2015). Immortalization and Characterization of Mouse Temporomandibular Joint Disc Cell Clones with Capacity for Multi-lineage Differentiation. Osteoarthritis and cartilage / OARS, Osteoarthritis Research Society, 23(9), 1532-1542.

+ Open protocol

+ Expand

Quantitative Analysis of Inflammatory Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted using TRIzol™ reagent (Invitrogen, Carlsbad, CA, USA) and total RNA extraction kit (QIAGEN, Hilden, Germany). Approximately 1 μg RNA was reverse-transcribed into cDNA using the PrimeScript™ reverse transcription kit (TaKaRa Bio, Shiga, Japan) according to the manufacturer's protocol. Expression levels of Il-1β, Il-6, Tnf-α, and β-Actin were examined using an ABI 7500 real-time PCR system (Applied Biosystems, Foster City, CA, USA). β-Actin was used as a reference gene to normalise gene expression. The results were expressed using the 2^−ΔΔCT method. The primer sequences used in real-time PCR analysis are listed in Table 1 [26 (link)].Table 1

Primer sequences of mouse inflammatory genes used in RT-PCT.

Table 1

Target Gene	Forward Primer Sequence (5′-3′)	Reverse Primer Sequence (5′-3′)
β-Actin	CTACCTCATGAAGATCCTGACC	CACAGCTTCTCTTTGATGTCAC
Il-1β	TCGCAGCAGCACATCAACAAGAG	TGCTCATGTCCTCATCCTGGAAGG
Il-6	CTGCAAGAGACTTCCATCCAG	GACTTTGAGGTTGACCTTCACAT
Tnf-α	ATGTCTCAGCCTCTTCTCATTC	GCTTGTCACTCGAATTTTGAGA

Meng X., Zhang W., Lyu Z., Long T, & Wang Y. (2022). ZnO nanoparticles attenuate polymer-wear-particle induced inflammatory osteolysis by regulating the MEK-ERK-COX-2 axis. Journal of Orthopaedic Translation, 34, 1-10.

+ Open protocol

+ Expand

Quantitative Analysis of Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted from the cell lines using the Total RNA Extraction Kit (Qiagen GmbH). cDNA was prepared using a HiScript^®III First-Strand cDNA Synthesis Kit (+gDNA wiper) (Vazyme Biotech Co., Ltd.) according to the manufacturer's instructions. Subsequently, qPCR was performed using ChamQ Universal SYBR qPCR Master Mix (Vazyme Biotech Co., Ltd.). Primers were synthesized by GenScript. The reaction steps were as follows: i) pre-denaturation at 95°C for 30 sec; ii) PCR reaction of 40 cycles at 95°C for 5 sec, followed by incubation at 60°C for 30 sec. The sequences of the β-actin and the ACKR primers are presented in Table I. Cycle thresholds were recorded and the relative expression of target genes was calculated and quantified using the 2^−∆∆Cq method with β-actin as the reference gene (24 (link)).

Yang L., Zhang S, & Pu P. (2023). Comprehensive analysis of ACKR family members in breast cancer using prognostic values. Oncology Letters, 26(4), 425.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!