Pyrophosphatase

Isopropyl-β-D-thiogalactopyranoside, L-Asparagine, Sodium ATP, Pyrophosphatase, malachite green solution and 4,6-diamidino-2-phenylindole dihydrochloride (DAPI) were purchased from Sigma Chemical Co. Dulbecco’s Modified Eagle Medium (DMEM), fetal bovine serum (FBS), penicillin, and streptomycin were purchased from PAN Biotech Aiden Bach, Bavaria. Matrigel was purchased from BD Biosciences. MTT reagent and all other chemicals were of the reagent grade and were obtained commercially.

The purified protein (10 μM) was incubated with 1 mM substrate in 100 μL of buffer, containing 2.8 mM hydroxylamine, 1 mM dithiothreitol (DTT), 0.4 U/mL pyrophosphatase (Sigma), 0.5 mM ATP, 10 mM MgCl₂, and 50 mM Tris-HCl (pH 7.5). The reaction was incubated for 30 min at 30 °C. Subsequently, a 50 μL portion of the mixture was quenched by adding 100 μL of the working reagent from the malachite green phosphate assay kit (Enzo). After a 20 min incubation at room temperature, the absorbance at 620 nm was measured. The control A₆₂₀ value was subtracted from the A₆₂₀ value of the reaction mixture, and then the relative adenylation activity was calculated.

Lysogeny broth (LB), isopropyl β-d-thiogalactopyranoside (IPTG), NAD⁺, and NADH were
purchased from Research Products International. The protease inhibitor
cocktail, lysozyme, DNase I, UDP-GlcNAc, ManNAc, neuraminic acid,
uridine 5′-diphosphate (UDP), cytidine 5′-triphosphate
(CTP), cytidine 3′,5′-cyclic monophosphate, phosphoenolpyruvate
(PEP), pyruvate kinase, lactate dehydrogenase, sialic acid aldolase,
pyrophosphatase, kanamycin, dithiothreitol (DTT), imidazole, and HEPES
were obtained from Sigma-Aldrich. Ammonium bicarbonate, 2-mercaptoethanol,
KCl, MnCl₂, and MgCl₂ were acquired from Sigma-Aldrich.
Vivaspin 20 spin filters and HisTrap and HiTrap Q HP columns were
obtained from Cytiva. The 10 kDa Nanosep spin filters were purchased
from Pall Corp. (Port Washington, NY). Deuterium oxide was acquired
from Cambridge Isotope Laboratories Inc., and ¹⁸O-labeled
water (98%) was obtained from Medical Isotopes Inc.

Time course ubiquitination assays were performed at 37°C in the presence of 80 nM E1, 2.8 μM E2, 1 μM SidC truncations or mutants, and 10 μM ubiquitin in a reaction buffer containing 50 mM Tris-HCl (pH 8.0), 5 mM MgCl2, 0.5 mM DTT, 50 mM creatine phosphate (Sigma P7396), 3 U/ml of pyrophosphatase (Sigma I1643), 3 U/ml of creatine phosphokinase, and 2.8 mM ATP. For ubiquitin consumption assays, SidC proteins were pre-incubated with 15 μl 1mM liposome suspensions containing PC/PS or PC/PS/PI(4)P for 30 min at room temperature before the ubiquitination reactions. All reactions were stopped by the addition of 5X SDS-PAGE loading buffer containing 250 mM BME and separated by SDS-PAGE. All the SDS gels were stained with Coomassie blue dye and the intensity of the ubiquitin protein bands was quantified using an Odyssey Infrared imaging system (LI-COR Biosciences). These assays were repeated in three independent experiments. The percentage of ubiquitin usage was averaged and plotted.

A 50mer DNA template (T₅₀dA) (5′- GCTGTGGCCGGTCTCTTGTAGAGGCGCCCGAACAGGGACGCCATTACAGC) was hybridized to a 5′ ³²P-labeled DNA primer (P₃₀) (5′-GCTCTAATGGCGTCCCTGTTCGGGCGCCTC) (biomers.net; Ulm, Germany) [4 (link)]. 20 nM of the T₅₀dA/P₃₀ substrate were pre-incubated for 2 min at 37°C with 0.08 U of pyrophosphatase (Sigma Aldrich Chemie GmbH, Taufkirchen, Germany) and 1.25 mM dATP (mismatch) or dTTP (match) in reaction buffer. Reactions were started by the addition of 1.25 μM enzyme and stopped after 12 min with an equal volume of urea loading buffer (see above). The reaction products were separated via denaturing gel electrophoresis (8% polyacrylamide/8 M urea gels) and analyzed as described above. Since the bands above P₃₁ all comprise the first correct dTTP incorporation they were also included in quantification of the primer extensions. Mean values and standard deviations of at least three independent experiments were analyzed in unpaired t-tests. Significant differences to the WT enzyme are indicated as p-values in Additional file 1: Table S1 and in Figure 4C by asterisks.

In vitro transcription reactions were performed using PCR products generated with primers encoding a flanking T7 RNA polymerase promoter and a poly-A tail. Reactions were set up, as previously described (66 (link)), with 20 mM Tris-HCl pH 7.5, 35 mM MgCl₂, 2 mM spermidine, 10 mM DTT, 1 u/ml pyrophosphatase (Sigma), 7.5 mM of each NTP, 0.2 u/ml RiboLock RNase Inhibitor (ThermoFisher), 0.1 mg/ml T7 RNA polymerase and 40 ng/μl PCR-generated DNA. After 3 h incubation at 37 °C, 0.1 u/μl DNase I (Promega) was added to the reactions, which were incubated at 37 °C for 30 min to remove the template DNA. RNA was precipitated for 2–3 h at −20 °C after adding 0.5x volume of 7.5 M LiCl/50 mM EDTA, and the resulting pellet was washed with cold 70% ethanol and dissolved with RNase-free water. The mRNA was further purified by using a Zymo RNA Clean and Concentrator (Zymo Research) before use in in vitro translation reactions.
DNA templates were amplified from a plasmid containing the corresponding 5’ UTR and the NanoLuc Luciferase coding sequence. Primers used for this amplification added a 30T sequence at the 3′ end to form a poly(A) tail after transcription. The HBB 5’ UTR containing mRNA was then capped using Vaccinia Capping enzyme (New England Biolabs) and 2′O-methylated using Vaccinia 2′O Methyltransferase (New England Biolabs). The IRES-containing mRNAs were uncapped and polyadenylated.