Usb poly a tail length assay kit

Polyadenylation length determination of ACTIN, LacZ and MCL1 in vector and eIF4E-FLAG cells was done using Affymetrix USB Poly(A) Tail-length Assay kit (Affymetrix, cat # 76435), as per manufactures instructions. PCR amplification was conducted using the following 10μM primers: ACTIN FWD: 5′ TCTCTCTAAGGAGAATGGC 3′, ACTIN polyA reverse: 5′ AAGTGCACACCTTAAAAATG 3′, LacZ FWD: 5′ CGTCAGTATCGGCGGAGTTC 3′, LacZ polyA reverse: 5′ TATCCCCACGCGCCCTGTA 3′, MCL1 FWD: 5′ AAAGGGAGGATTTGCTTAG 3′ and MCL1 polA reverse: 5′ CTAACTTTCTGTTTTTCCTGAG 3′. All primers purchased from IDT, see Table S1.

Staged young adult tau transgenic C. elegans were grown from eggs at 20 °C for 3 days on 5XPEP plates, washed off plates in M9 buffer, and collected by centrifugation. RNA was extracted from ~100 μL of packed worms per sample using Tri-Reagent (Molecular Research Center) as per manufacturer instructions. Poly(A) tail lengths were assayed using the USB Poly(A) Tail-Length Assay Kit (Affymetrix) as per manufacturer instructions with the following modification to the PCR amplification step. The PCR reaction consisted of 10 μL of HotStart Taq, 7 μL of nuclease-free water, 0.5 μL of 10 μM gene-specific primer (see below), 0.5 μL of 10 μM Universal PCR Reverse Primer, and 2 μL of the diluted reverse transcription sample. A three-step PCR reaction with 40 cycles of amplification was used to amplify the signal. PCR products were run on a QIAexcel Advanced capillary electrophoresis instrument (Qiagen) using a QIAxcel DNA high resolution Kit with QX DNA Size Marker pUC18/HaeIII (catalog #929550) at 20 ng/uL and QX alignment marker 15 bp/600 bp (catalog #929530). Samples were processed using the 0M400 method with a 20 s sample injection time and analyzed with the QIAxcel ScreenGel Software for major peak, median signal, and concentration.

The poly(A) tail-length of the Avp mRNA was examined using the USB poly(A) Tail-Length Assay Kit (Affymetrix). RNA extracted from SON (50 ng) was used as the starting material. Guanosine and inosine residues were added to the 3’ ends of poly(A)-containing RNAs using poly(A) polymerase enzyme. After incubation at 37°C for 1 hour, stop solution was added and the tailed-RNAs were converted to cDNA by reverse transcription (RT) using the newly added G/I tails as priming sites. PCR amplification products were generated by using two primer sets: Set 1, gene-specific forward and reverse primer set for Avp (forward 5’-CGAGTGTCGAGAGGGTTTTT-3’, reverse 5’-TTTATTTTCCATGCTGTAGG-3’) and Set 2, Avp gene-specific forward primer and a universal reverse primer provided in the kit. PCR reactions were performed using 2 µl of undiluted RT sample. PCRs were performed using the following cycling conditions; 94°C for 2 minutes followed by 40 cycles of 94°C for 10 seconds, 60°C for 45 seconds and 72°C for 5 minutes. The PCR products were separated on 2.5% (w/v) agarose/TAE gel. The PCR products were visualised on ethidium bromide-stained gels using a Syngene G:BOX imaging system.

USB® Poly(A) Tail-Length Assay Kit (Affymetrix, 76455) based on HIRE-PAT method, was used. Frontal cortex - BA8/9 of ASD patients (n = 3) and CTRL (n = 3) and total striatal RNA from 1.5 month-old control and TgCPEB4∆4 mice (n = 3) was extracted using the Maxwell® 16 LEV simplyRNA Tissue Kit (Promega, AS1280) and stored at -80ºC until use. G/I tailing (1 μg of total RNA) and reverse transcription were performed according to the manufacturer’s instructions. Poly(A) size was determined by subtracting the PCR amplicon size obtained with the Universal primer and forward specific primers. To verify that the measured poly(A) tail corresponds to specific gene three different forward specific primers were tested (Supplementary Table 7). PCR products were resolved on 2.5% agarose/gelgreen (Biotium, 41004) gels run at 120V for 1.5h.