For qPCR, the HiScript One Step qRT-PCR Probe Kit (Vazyme, Q222-01) was used to detect the viral RNA copies, and SYBR Green Kit was used to analyze expression of cellular genes on a Mx3005P Real-Time PCR system (Agilent, United States). Gene-specific primers are listed in
Sybr green kit
The SYBR Green kit is a reagent designed for use in quantitative real-time polymerase chain reaction (qRT-PCR) assays. The kit contains SYBR Green I dye, which binds to double-stranded DNA and emits fluorescent signals that can be detected and measured during the PCR process. This allows for the quantification of target DNA sequences in real-time.
Lab products found in correlation
6 protocols using sybr green kit
Quantitative Real-Time PCR for Viral RNA and Host Gene Expression
For qPCR, the HiScript One Step qRT-PCR Probe Kit (Vazyme, Q222-01) was used to detect the viral RNA copies, and SYBR Green Kit was used to analyze expression of cellular genes on a Mx3005P Real-Time PCR system (Agilent, United States). Gene-specific primers are listed in
Quantitative gene expression analysis
Quantitative RT-PCR Analysis of Kidney Gene Expression
Primer sequences for RT-PCR
Primers | Accession no. | Sequence (5′–3′) |
---|---|---|
PKC-α | ||
Forward | NM_011101.3 | CCCATTCCAGAAGGAGATGA |
Reverse | NM_011101.3 | TTCCTGTCAGCAAGCATCAC |
α-SMA | ||
Forward | XM_006526606.2 | ACTGCCGAGCGTGAGATTGT |
Reverse | XM_006526606.2 | TGATGCTGTTATAGGTGGTTTCG |
TGF-β1 | ||
Forward | NM_011577.2 | CGAAGCGGACTACTATGCTAAAGAG |
Reverse | NM_011577.2 | TGGTTTTCTCATAGATGGCGTTG |
GAPDH | ||
Forward | XM_017321385.1 | CAGCCTCGTCCCGTAGACA |
Reverse | XM_017321385.1 | CGCTCCTGGAAGATGGTGAT |
Quantitative Gene Expression Analysis
RT-qPCR Validation of High-Throughput Small-RNA Analyses
Quantifying Circulating miRNA Levels
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!