Bulge loop mirnaqrt pcr primer kit

Total RNA, including miRNAs, was extracted from human tissues, mouse xenografts and cell lines using the TRIzol reagent (Invitrogen, San Diego, CA, USA) according to the manufacturer's protocol. RNAs were reverse-transcribed using the RevertAid First Strand cDNA Synthesis Kit (Thermo, Waltham, MA, USA). All primers are listed in Supplementary Table 1. For quantification of miR-129, the Bulge-LoopTM miRNA qRT-PCR Primer Kits (Ribobio, Guangzhou, China) were utilized following the manufacturer's instructions. qPCR was performed using SuperReal PreMix (SYBR Green) (Tiangen, Beijing, China) with an iCycler thermal cycler (ABI QuantStudio™6 FLEX, USA). The expression of mRNA or miRNA was defined from the threshold cycle (Ct), and relative expression levels were calculated using the 2^−ΔΔCt method after normalization with reference to the expression of GAPDH or U6 snRNA.

Total RNA from tissues or cells was extracted with Trizol reagent (Invitrogen, USA) under the manufacturer's instruction. RNA concentration was measured by NanoDrop-2000 (Thermo Fisher, USA). 2.5 μg of total RNA was used for cDNA synthesis with RevertAid First Strand cDNA Synthesis kit (Thermo Fisher, USA). Expression levels of mature miR-9 were detected by the Bulge-LoopTM miRNA q-RT-PCR primer kits (RiboBio, Guangzhou, China). Roche light Cycler 480 mix (Roche, Mannheim, Germany) was employed to perform real-time PCR on a CFX 96 Real-Time PCR Detection System (Bio-rad, USA). GAPDH mRNA or U6 snRNA was used as the internal control. Sequences of real-time PCR primers were listed in Table 1.

RNA was extracted from cell lines and fresh tissues using TRIzol reagent (Life Technologies, CA, USA) following the manufacturer’s protocol. Quantitative real-time PCR was conducted using the ABI StepOne Plus system (Applied Biosystems, CA, USA) with a Bulge-loop™ miRNAqRT-PCR Primer Kit (Ribobio, GuangZhou, China) to detect miR-141-3p level. Primers were purchased from Ribobio (GuangZhou, China). Data were analyzed by the 2^−ΔΔCt method and U6 was used as an endogenous control.

Real‐time PCR was performed as previously research.²⁵, ²⁶ TRIzol reagent from Life Technologies was used to isolate RNA from fresh tissues and fresh tissues as per the protocol of the manufacturer. Quantitative real‐time PCR was carried out to estimate the level of miR‐155‐3p on the Applied Biosystems ABI StepOne Plus system using the Bulge‐loop™ miRNA qRT‐PCR Primer Kit using appropriate primers (Ribobio). Analyses of data were done by the 2^−ΔΔCt process, and the endogenous control was U6. The primers used in this study are listed as follows: miR‐155‐3p, Forward: 5′‐ GACCAACAGCATCACCCTTGA‐3′, Reverse: 5′‐ ACTGCAGGAAGCTATACCAGG‐3′; U6, Forward: 5′‐CTCGCTTCGGCAGCACA‐3′, Reverse: 5′‐AACGCTTCACGAATTTGCGT‐3′.

Total RNA extraction from renal tissue specimens and NRK-52E cells was carried out with TRIzol reagent (Invitrogen, U.S.A.). A RevertAid™ First Strand cDNA Synthesis Kit (Thermo, U.S.A.) was employed for cDNA production. Subsequently, Talent qPCR PreMix (SYBR Green) (Tiangen, Beijing, China) was employed for qPCR. The corresponding primer sequence is shown in Table 1. Reverse transcription and quantitative detection of miR-27a were performed based on the protocols included in the RevertAid™ First Strand cDNA Synthesis Kit and Bulge-Loop™ miRNA qRT-PCR Primer Kit (RiboBio, Guangzhou, China), respectively. Relative quantification was carried out with the 2^−ΔΔCt method; U6 or β-actin served as an internal control.

Total RNA was isolated from tissue and cell specimens using Trizol (TaKaRa, China), and total RNA was extracted according to the manufacturer’s instructions. The RNA concentration was measured with a BioSpectrometer (Eppendorf, Germany). The RNA samples were reversely transcribed into cDNA using the TransScript RT reagent Kit (TransGen, China). QRT-PCR was performed with FastStart Universal SYBR Green Master (ROX) (Roche, USA). β-actin and U6 were used to normalize the level of mRNA and miRNA expression, respectively. β-actin primers were 5′-CTGGAACGGTGAAGGTGACA-3′ and 5′-AAGGGACTTCCTGTAACAATGCA-3′; PHLPP2 primers were 5′-CCAATGAGCAAGGACAGGAT-3′ and 5′-GGTCCTCTGGTTCCATCTGA-3′. The Bulge-Loop miRNA qRT-PCR Primer kit (RIBOBIO, China) was used for detecting miR-27a expression. QRT-PCR was performed using the CFX96 Real-Time system (Bio-Rad, USA), and the data were analyzed using the 2^∆∆CT method.

Total RNA was purified from kidneys and cells with TRIzol reagent (Invitrogen, USA) as described by the manufacturer. The Bulge-Loop™ miRNA qRT-PCR primer kit (Ribobio, China) was used to assess miR-21 expression levels. In addition, qPCR was carried out with SuperReal PreMix (SYBR Green) (Tiangen, China) and iQ SYBR Green SuperMix (Bio-Rad). The gene expression levels were normalized to those of GADPH or U6. The Bulge-Loop™ RT primer and qPCR primers specific for miR-21 and U6 genes were designed and synthesized by RiboBio (RiboBio, China). The 2−ΔΔCt method was employed for quantification. The sequences of the other primers used are described in Table 1.
The PPARα-promoter luciferase reporter was constructed by Longqian Biotech (China). Actively proliferating HK-2 cells were trypsinized and seeded in plates at a suitable density for routine culture. Following 24 h of incubation, transfection was carried out with Lipofectamine 3,000 (Invitrogen) as directed by the manufacturer for 48 h. This was followed by cell lysis and sample analysis with a Dual-Luciferase Reporter Assay System (E1960; Promega, USA). Renilla and Firefly luciferase activities were measured, and the ratio of Renilla luciferase activity to that of Firefly luciferase was derived. Triplicate experiments were independently repeated 3 times.