We raised p75NTR−/− mice in the Wenzhou Medical University Animal Laboratory. The differences in body weights and appearances between p75NTR−/− and p75NTR+/+ mice were compared. Additionally, we dissected the tail tissue for PCR analysis as previously described [17 (link)]. DNA extraction and PCR amplification were using one step mouse genotyping kit (Vazyme, Nanjing, China) according to the manufacturer’s protocol. The PCR products could be observed on a 3% agarose gel containing 5 mg/mL ethidium bromide.
One step mouse genotyping kit
Manufactured by Vazyme
Sourced in China
The One Step Mouse Genotyping Kit is a laboratory equipment product designed for the rapid and efficient genotyping of mouse samples. It provides a streamlined process for DNA extraction and PCR amplification, enabling researchers to quickly and accurately identify genetic characteristics of mice.
Automatically generated - may contain errors
Lab products found in correlation
Amersham imager 680, by GE Healthcare (4 mentions)
App ps1 jax, by Jackson ImmunoResearch (2 mentions)
C57bl 6 mice, by GemPharmatech (2 mentions)
S1000 thermal cycler, by Bio-Rad (2 mentions)
Fvb cg tg smn2 2hung smn1tm1hung j, by Jackson ImmunoResearch (1 mentions)
Superred gelred, by Biosharp (1 mentions)
Taq plus master mix, by Vazyme (1 mentions)
Spcrtta, by Jackson ImmunoResearch (1 mentions)
21 protocols using one step mouse genotyping kit
1
Genotyping p75NTR Knockout Mice
2
Genotyping of Transgenic Mice
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Tail clippings were obtained from 4-week-old mice. Mouse tail DNA was extracted using a One Step Mouse Genotyping Kit (PD101-01, Vazyme, China) according to the manufacturer’s instructions. Agarose (1.5 g), 100 mL of 2 * Tris–acetate-EDTA buffer (TAE) and 6 ul of Gel Red were mixed and heated to form agarose gels. The amplified DNA was subjected to agarose gel electrophoresis. Images were captured using an Amersham Imager 680 (GE, USA). The primers used for amplification (GPX4flox, Piezo1flox and Col2a1-CreERT) are listed in Table 1 .
Primers used for gene identification
| Target | Forward primers, 5ʹ–3ʹ | Reverse primers, 5ʹ–3ʹ |
|---|---|---|
| GPX4flox | TCCATTGGTCGGCTGCGTGAGG | ACCCTGGATACGGTGACCCGAC |
| Piezo1flox | AGCAAGGCCAATGTAGTATCTGG | CTATTGGTGCCTAGTTGGCAGAC |
| Col2a1-CreERT | CACTGCGGGCTCTACTTCAT | ACCAGCAGCACTTTTGGAAG |
3
Genotyping of Transgenic Mice
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Tail clippings were obtained from 4-week-old mice. Mouse tail DNA was extracted using a One Step Mouse Genotyping Kit (PD101-01, Vazyme, China) according to the manufacturer’s instructions. Agarose (1.5 g), 100 mL of 2 * Tris–acetate-EDTA buffer (TAE) and 6 ul of Gel Red were mixed and heated to form agarose gels. The amplified DNA was subjected to agarose gel electrophoresis. Images were captured using an Amersham Imager 680 (GE, USA). The primers used for amplification (GPX4flox, Piezo1flox and Col2a1-CreERT) are listed in Table 1 .
Primers used for gene identification
| Target | Forward primers, 5ʹ–3ʹ | Reverse primers, 5ʹ–3ʹ |
|---|---|---|
| GPX4flox | TCCATTGGTCGGCTGCGTGAGG | ACCCTGGATACGGTGACCCGAC |
| Piezo1flox | AGCAAGGCCAATGTAGTATCTGG | CTATTGGTGCCTAGTTGGCAGAC |
| Col2a1-CreERT | CACTGCGGGCTCTACTTCAT | ACCAGCAGCACTTTTGGAAG |
4
Mouse Genotyping Using One-Step Kit
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Genotyping of mice was performed using the One-Step Mouse Genotyping Kit (Vazyme Biotech co., Ltd). After a 3 mm mouse tail was cut into pieces, freshly prepared 200 µL 1x lysis buffer was added to it. The tails were incubated in a 55 °C water bath for 20 min after vortex oscillation. Then, the samples were placed in a 95 °C water bath for 5 min to inactivate Proteinase K. After the vortex oscillation of the pyrolysis products, centrifugation was performed at 12,000 rpm for 5 min at 4 °C, and the supernatant was collected for PCR reaction. Refer to the Jackson Laboratory's website for detailed reaction conditions and primers (http://jaxmice.jax.org/strain/ ).
5
Genotyping of Conditional Knockout Mice
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Tail clippings were obtained from 4-week-old mice. Mouse tail DNA was extracted using a One Step Mouse Genotyping Kit (Vazyme, China, Cat# PD101-01) according to the manufacturer’s instructions. The primers used for amplification (GPX4flox and Col2a1-CreERT) are listed in Table S1 . Agarose (1.5 g), 100 mL of 2* Tris-acetate-EDTA buffer (TAE) and 6 µl of Gel Red were mixed and heated to form agarose gels. The amplified DNA was subjected to agarose gel electrophoresis. Images were captured using an Amersham Imager 680 (GE, USA). The positive genotype Col2a1-CreERT was a 358 bp band, and no band was detected for the wild-type allele. The GPX4flox/flox alleles were present as a 238 bp band, the wild-type alleles (GPX4+/+) were detected as a 204 bp band, and the GPX4flox/+ genotype was detected as two bands at 238 and 204 bp. The primers are listed in Table S1. The results are listed in Figure S2 B-C .
6
Genomic DNA extraction and PCR-based gene editing assessment
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Genomic DNA of HEK293T and PFF cells was extracted using One Step Mouse GenoTyping Kit (Vazyme, Nanjing, China). The cell lysate was then used as the PCR template. PCR fragments for Sanger sequencing were generated in one step PCR reaction. The editing efficiency was analyzed by an online tool, EditR 1.0.9.1 The primers are listed in Supplementary Table S3 .
7
Transgenic Mouse Models for AD
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
APP/PS1 (JAX, Stock # 034848) and 5×FAD (JAX, Stock # 034848) transgenic mice were purchased from The Jackson Laboratory and generously provided by Dr. Guobing Chen (Jinan University, China). In this study, we crossed the APP/PS1 or 5×FAD with C57BL/6 mice (GemPharmatech, China) to obtain daughter mice for further study. All mice were maintained under standard laboratory conditions with free access to food and water unless otherwise indicated. All experiments were conducted in accordance with the regulations for the Administration of Affairs Concerning Experimental Animals (China) and approved by the China Pharmaceutical University Animal Ethics Committee. Mice were genotyped by One Step Mouse Genotyping Kit (Vazyme, Cat# PD104-01), according to manufacturer's instructions.
8
Genotyping of Creg1 Heterozygous Mice
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Genomic DNA from tail tips of WT and Creg1+/- mice was extracted by a One Step Mouse Genotyping Kit (Vazyme Biotech, Nanjing, China) and used as template for amplification of WT and Mutant Creg1 gene by PCR. Since the exons 2 and 3 of one Creg1 allele were replaced with a neomycin-resistant (NeoR) cassette in Creg1+/- mice, Creg1 heterozygosity was confirmed by detection of both WT and NeoR cassette. Two primer sequences used for genotyping were 5’-TGTCGGGAACTGTGACCAAG-3’ (forward) and 5’-CTTTAGGTCCACCAAAGTAG-3’ (reverse) for the WT Creg1, and 5’-CTCAGCCTTGGGGGTGCTGGGAAGA-3’ (forward) and 5’-TCGTCGTGACCCATGGCGATGCCTG-3’ (reverse) for mutant Creg1, respectively.
9
Generation of SMA Mouse Models
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The Taiwanese SMA mice used in this study was a gift from Professor Hua Yimin at Soochow University and was originally purchased from the Jackson Laboratory (FVB.Cg-Smn1tm1HungTg (SMN2)2Hung/J, stock number 005058) [35 (link),99 (link)]. There are two genotypes of this mouse, severe (Smn-/-, SMN22tg/0) and mild (Smn-/-, SMN22tg/2tg). Severe and control mice (Smn+/-, SMN22tg/0) were sequenced in this project, generated by crossing Het knockout mice (Smn+/-) with mild Taiwanese mice (Smn-/-, SMN22tg/2tg). Genotyping of tail-end tissue from newborn mice was performed using the method described in One step mouse genotyping kit (PD101-01, vazyme, nanjing, china). A Primer pair (F: 5’-AGCCTGAAGAACGAGATCAGC-3’, R: 5’-GTAGCCGTGATGCCATTGTCA-3’) was used to detect the mutant allele. A primer pair (F: 5’- ATAACACCACCACTCTTACTC -3’, R: 5’- GTAGCCGTGATGCCATTGTCA -3’) was used to detect the wild-type allele. Three littermates of SMA or control mice were pooled into one sample for scRNA-seq. Bulk-seq was done in triplicates (n = 1 per group in SMA or control).
10
Genotyping Mouse Samples via PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
DNA extraction was performed according to the protocol of the One Step Mouse Genotyping Kit (Vazyme Biotech, Nanjing, China) using mouse tails. DNA extracts (2 μL) were added to a 20 μL PCR reaction system containing 2× Taq Plus Master Mix, primers and nuclease‐free water (Vazyme Biotech, Nanjing, China). The PCR conditions were as follows: initial denaturation at 95°C for 3 min, then 30 cycles at 95°C for 15 s, 60°C for 15 s, and 72°C for 1 min, with final extension at 72°C for 5 min. DNA amplification was conducted in a S1000 Thermal Cycler (Bio‐Rad, USA). Amplified fragments were separated on a 2% agarose gel containing SuperRed/GelRed (Biosharp, Wuhan, China) under standard electrophoresis conditions and visualized under a UV light illuminator. Genotype was analyzed using primers and PCR conditions described previously.19 , 22 , 24 , 25 The primers used in the PCR were as follows: Flox forward primer: 5′‐TGGCTGCTACTTCTGCAATGATGT‐3′, reverse primer: 5′‐GAGGACAGAGACCATCAGCTCCAC‐3′; ATG7 wild‐type (WT) forward primer: 5′‐ATTGTGGCTCCTGCCCCAGT‐3′, reverse primer: 5′‐GAGGACAGAGACCATCAGCTCCAC‐3′; Cre forward primer: 5′‐GCATTTCTGGGGATTGCTTA‐3′, reverse primer: 5′‐CCCGGCAAAACAGGTAGTTA‐3′.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!