For data analyses, a standard curve was constructed by amplification of serially diluted plasmids containing the target sequence. Data were analyzed at the termination of each assay using Sequence Detection Software (Sequence Detection Software, version 1.3.1; Applied Biosystems, Norwalk, CT, USA; Girard et al., 2008 (link), 2010 (link), 2013 (link), 2016 (link); Gonzalez et al., 2013 (link)) as previously described. Data are expressed as the relative quantity of the gene of interest normalized to the relative quantity of the housekeeping gene, ribosomal protein L32.
Sequence detection software
Manufactured by Thermo Fisher Scientific
Sourced in United States
Sequence Detection Software is a software application developed by Thermo Fisher Scientific for the analysis and interpretation of genetic sequences. It provides tools for primer and probe design, data analysis, and visualization of real-time PCR (Polymerase Chain Reaction) results.
Automatically generated - may contain errors
Lab products found in correlation
Taqman assay, by Thermo Fisher Scientific (5 mentions)
Qiaamp dna blood maxi kit, by Qiagen (3 mentions)
Abi 7500 fast real time pcr system, by Thermo Fisher Scientific (3 mentions)
Nanodrop nd 1000, by Thermo Fisher Scientific (3 mentions)
Taqman probe, by Thermo Fisher Scientific (3 mentions)
7900ht thermocycler, by Thermo Fisher Scientific (2 mentions)
Abi prism 7500, by Thermo Fisher Scientific (2 mentions)
Abi prism 7300, by Thermo Fisher Scientific (2 mentions)
Superscript 3, by Thermo Fisher Scientific (2 mentions)
Abi 7700, by Thermo Fisher Scientific (2 mentions)
Rnaiso plus, by Takara Bio (2 mentions)
Rneasy plus kit, by Qiagen (1 mentions)
Superscript 3 first strand synthesis kit, by Thermo Fisher Scientific (1 mentions)
Puregene dna isolation kit, by Qiagen (1 mentions)
Taqman universal pcr master mix, by Thermo Fisher Scientific (1 mentions)
7300 ht sequence detection system, by Thermo Fisher Scientific (1 mentions)
Taqman snp genotyping assay, by Thermo Fisher Scientific (1 mentions)
Power sybr green pcr master mix, by Thermo Fisher Scientific (1 mentions)
Massarray technology platform, by Labcorp (1 mentions)
Iplex gold chemistry, by Labcorp (1 mentions)
33 protocols using sequence detection software
1
Quantitative Real-Time PCR Analysis
2
Quantitative gene expression analysis of ccRCC
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Gene expression values from RNA sequencing data from primary ccRCC and normal renal cortex tissues were obtained from The Cancer Genome Atlas expression browser [24] (link). For real-time gene expression assays, RNA was extracted using RNeasy Plus kits (Qiagen, Valencia, CA). The cDNA was synthesized using random hexamers and the Superscript III First-Strand Synthesis Kit and was used to seed real-time SYBR Green or Taqman PCR reactions for each gene (Supplementary Table S2 ) using standard cycling conditions for the Applied Biosystems 7900HT thermocycler. The presence of a single peak in the dissociation curve analysis was confirmed for all SYBR Green assays. Cycle threshold (Ct) values were determined using the Applied Biosystems Sequence Detection Software. All qPCRs were performed in triplicate except for those with samples H24 and H25, which were performed in duplicate. The coefficient of variance of the mean Ct values for all assays was less than 2.5%. Relative quantification was calculated as 2–delta Ct, where delta Ct values were obtained by subtracting the control gene mean Ct value from the target gene mean Ct value using the control gene HMBS, which was previously shown to be stable in comparisons of primary RCC and normal kidney tissues [25] (link).
3
Genomic DNA Genotyping via TaqMan Assay
4
Quantitative PCR Data Analysis Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For data analysis, we constructed a standard curve by amplification of serially diluted plasmids containing the target sequence. The data were analyzed at the termination of each assay utilizing sequence detection software (version 1.3.1, Applied Biosystems, Norwalk, CT). In standard assays, default baseline settings were selected and the increase in SYBR green I fluorescence intensity (ΔRn) was plotted as a function of cycle number. The threshold cycle was determined by the software as the amplification cycle at which ΔRn first intersects the established baseline. Normalized data are expressed as the relative quantity of the gene of interest normalized to the relative quantity of the housekeeping gene L32 or an average of 18S and L32 housekeeping genes.
5
Genetic Polymorphism Analysis Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
5 mL of the venous blood was collected into plain (coagulated) and EDTA (anticoaggulated) tubes. Plain vacutainer consist of 3 mL of the serum sample was used to analyze the biochemical parameters and 2 mL of the EDTA sample was used for molecular analysis. Genomic DNA was extracted from peripheral blood leukocytes using Norgen DNA extraction kit (Norgen Biotek corp, Canada). DNA samples were stored at -80°C. The rs1799883 polymorphism was genotyped using a TaqMan® SNP genotyping assay (Assay ID: C_2834835_10) on a 7300HT sequence detection system (Applied Biosystems, USA). Primers and probes were obtained from Applied Biosystems as Assays-by-Design™. Cases and controls were ensured to have even treatment during the assay procedure, and each plate included negative controls (with no DNA). Plates were read on the ABI Prism 7300 using the Sequence Detection Software (Applied Biosystems) using 40 PCR cycles (92°C denaturation for 15 seconds, 60°C annealing/extension for 60 seconds). Measurements were repeated for samples with failed genotypes. Assays that did not show >95% concordance were discarded and replaced with alternative assays with the same tagging properties.
6
Quantitative RT-PCR Analysis of Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNAs were isolated from strains grown in YEME medium as described previously [11 (link)]. Quality and quantity of RNAs were examined by UV spectroscopy and checked by agarose gel electrophoresis. To erase the chromosomal DNA contamination, each sample was treated with DNase I and tested by PCR to ensure that there was no chromosomal DNA left. After DNase treatment, RNA samples (1 μg) were reversely transcribed using SuperScript™ III and random hexamers (N15) as described by the vendor of the enzyme (Invitrogen). The probe PRT27 was amplified by the primers RT3127F/RT3127R; the probe PRT28 was amplified by the primers RT3128F/RT3128R. The relative level of amplified mRNA was normalized to mRNA expression of the housekeeping gene hrdB, which was amplified as an internal control using the primers RThrdB-F/RThrdB-R. Each reaction (20 μL) contained 0.1–10 ng of reversely-transcribed RNA depending on dilution, 10 μL Power SYBR Green PCR Master Mix (Applied Biosystems), 0.6 μM of both forward and reverse primers, respectively. The size of each amplicon is provided in parenthesis. The PCR reactive conditions were 50 °C for 2 min, 95 °C for 10 min followed by 40 cycles of 96 °C for 30 s, 60 °C for 1 min, fluorescence was measured at the end of each cycle. Data analysis was made through Sequence Detection Software supplied by Applied Biosystems.
7
Robust Genotyping Techniques for Variant Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Genotyping was performed by the Sequenom MassARRAY technology platform using iPLEX GOLD chemistry (Sequenom, San Diego, CA). Briefly, specific assays were designed using the MassARRAY AssayDesign software package with filtering of proximal SNPs and checking of specificity for PCR amplification and the subsequent primer extension reaction. SpectroTyper 4.0 was used to call genotypes automatically, followed by manual review.
As a secondary platform, PCR-based TaqMan assays (Applied Biosystems, Foster City, CA) were performed according to the manufacturer’s instructions, and the results were analyzed on the ABI Prism 7500 using Sequence Detection Software (Applied Biosystems Co. Ltd., USA). To confirm the accuracy of the genotyping results, 10% of the samples of each SNP were randomly selected to be tested twice by different lab personnel; the reproducibility was 100%.
As a secondary platform, PCR-based TaqMan assays (Applied Biosystems, Foster City, CA) were performed according to the manufacturer’s instructions, and the results were analyzed on the ABI Prism 7500 using Sequence Detection Software (Applied Biosystems Co. Ltd., USA). To confirm the accuracy of the genotyping results, 10% of the samples of each SNP were randomly selected to be tested twice by different lab personnel; the reproducibility was 100%.
8
Genotyping of CLU, APOE Polymorphisms
9
Quantifying Hippocampal Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA from hippocampus was isolated by the Total RNA extraction reagent RNAiso Plus (9108/9109, Takara, Japan). Reverse transcription used PrimeScript™ RT Master Mix (Takara, Japan) and PCR used TB Green Premix Ex (Takara, Japan). The threshold cycle (Ct) was acquired with Sequence Detection Software (Applied Biosystems, USA). The analysis of results was by ΔΔCt method and every target mRNA was normalized with the GAPDH. Primer sequences of DHCR24, HMGCR, SREBP2 and GAPDH were shown in Table 1 .
List of primers and primer sequences
| Genes | Forward primer (5ʹ–3ʹ) | Reverse primer (5ʹ–3ʹ) |
|---|---|---|
| DHCR24 | CGCTGCGAGTCGGAAAGTA | GTCACCTGACCCATAGACACC |
| HMGCR | ATGCCTTGTGATTGGAGTTG | GTTACGGGGTTTGGTTTATT |
| SREBP2 | GCAGCAACGGGACCATTCT | CCCCATGACTAAGTCCTTCAACT |
| GAPDH | CTGCCCAGAACATCATCC | CTCAGATGCCTGCTTCAC |
10
Quantitative Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
All samples were analyzed in duplicate, and the fluorescence reaction was quantified with an ABI Prism 7300 sequence detector (Applied Biosystems) on the basis of current methodology (Bustin et al., 2009 (link)). The amplification analysis was performed with a sequence detection software (Applied Biosystems). Results were expressed using the comparative cycle threshold (Ct) method described in the manufacturer´s User Bulletin n⍛2 (Applied Biosystems). The Ct represents the PCR cycle at which an increase in reporter gene fluorescence above a baseline signal can be detected. For each gene of interest, ΔCt values were calculated for all samples as follows: Ct (gene of interest) - Ct (internal control gene). The ribosomal protein large P0 was used as a housekeeping gene (Bustin et al., 2009 (link)).
The calculation of the relative changes in the expression levels of one specific gene was performed by subtracting pre to posttest ΔCt values for each experimental group. The values and ranges given were determined as follows: 2- ΔΔCt with ΔΔCt ± SEM (SEM is the SE of the mean ΔΔCt value; User Bulletin n⍛ 2; Applied Biosystems). The final values were reported as a fold difference relative to the expression of the pretest values (calculated as 2-ΔΔCt), with the pretest values arbitrary set to 1.
The calculation of the relative changes in the expression levels of one specific gene was performed by subtracting pre to posttest ΔCt values for each experimental group. The values and ranges given were determined as follows: 2- ΔΔCt with ΔΔCt ± SEM (SEM is the SE of the mean ΔΔCt value; User Bulletin n⍛ 2; Applied Biosystems). The final values were reported as a fold difference relative to the expression of the pretest values (calculated as 2-ΔΔCt), with the pretest values arbitrary set to 1.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!