Chamq sybr qpcr master mix high rox premixed

Total RNA of seeds or other tissues were extracted using an EasyPure RNA Kit (TransGen Biotech, Beijing, China). About 1 μg of total RNA was used in reverse transcription (Tiangen, China) for SYBR detection of RT-qPCR products. The ChamQTM SYBR qPCR Master Mix (High ROX Premixed) (Vazyme, Nanjing, Jiangsu, China) was used to detect the expression levels of genes. In the experiment, GmUKN2 (Glyma.06G04180) was used as the internal reference gene [35 (link)] for the detection of gene expressions. All primers are listed in Supplemental Table S4.

Viral load was measured by quantitative real-time PCR (qRT-PCR) on RNA extracted from the supernatant of lung homogenates as reported previously (35 (link)). Briefly, lung homogenates were prepared by homogenizing perfused lung using an electric homogenizer. The inactivated samples were transferred from the BSL-3 to BSL-2 laboratory and total RNA was extracted from the collected supernatant. Each RNA sample was reverse transcribed to 50 μl cDNA with HiScript II Q RT SuperMix for qPCR (+gDNA wiper) (R223-01). Approximately 5 μl cDNA was added into a 25 μl qRT-PCR reaction containing the ChamQ SYBR qPCR Master Mix (High ROX Premixed) (Q341-02, Vazyme Biotech, China) and primers designed to target the nucleocapsid protein of SARS-CoV-2 (5′- GGGGAACTTCTCCTGCTAGAAT -3′ and 5′- CAGACATTTTGCTCTCAAGCTG -3′). The samples were run in triplicate on an ABI 7900 Real-Time System (Applied Biosystems, Thermo Fisher Scientific). The following cycling conditions were performed: 1 cycle of 50°C for 2 min, 1 cycle of 95°C for 10 min, and 40 cycles of 95°C for 15 s and 58°C for 1 min.

Cells were collected to extract total RNA using TRIzol (Invitrogen, 15596-026) according to the manufacturer’s instructions. Subsequently, cDNA was synthesized with the HiScript II Q RT SuperMix for qPCR (+gDNA wiper) (Vazyme Biotech, R223-01). Relative real-time quantitative PCR was performed on a CFX Real-Time PCR system (Bio-Rad) using ChamQ SYBR qPCR Master Mix (High ROX Premixed) (Vazyme Biotech, Q341-02). The specific primer sequences were as follows: 5′-GCCATTCTGATTTGCTGC-3′ (forward) and 5′-CCTTTCCTTGCTAACTGC-3′ (reverse) for CXCL10, 5′-GGAAATCCCATCACCATC-3′ (forward) and 5′- CATCACGCCACAGTTTCC-3′ (reverse) for GAPDH. The expression difference was calculated on the basis of 2^-ΔΔCt values.

Tomato leaf treatment and RNA and cDNA preparation were performed using the same conditions as described for the transcriptome analysis. qRT-PCR was performed with cDNA samples using ChamQ SYBR qPCR Master Mix (High ROX Premixed) (Vazyme Biotech, Nanjing, Jiangsu Province, China) and gene-specific primers (Table S5) in a CFX Connect Real-Time PCR detection system (Bio-Rad, Hercules, CA, USA). Briefly, the 20 μL reaction volume consisted of 10 μL qPCR master mix containing SYBR Green, 1 μL cDNA, and 0.2 μM of each primer and was incubated with the following program: 95 °C for 30 s followed by 40 cycles of 95 °C for 10 s, 60 °C for 30 s, and a final melting curve analysis (95 °C for 15 s, 60 °C for 60 s, 95 °C for 15 s). Expression levels were calculated using the threshold cycle (Ct) values for each gene with the Relative Expression Software Tool (REST) [61 (link)]. PCR efficiency for each reaction was obtained from the slope of the standard curves, where efficiency = 10^−1/slope [62 (link)]. The tomato actin gene [63 (link)] was used as the reference gene for normalizing Ct values. The 0 hpt cDNA sample served as a calibrator and was set at the value 1. Three independent experiments were performed.

FastPure Cell/Tissue Total RNA Isolation Kit V2 (Vazyme, Nanjing, China) was chosen to conduct total RNA extraction. The following measurements of RNA concentration and purity was achieved with Onedrop. RNA was reversely transcribed into cDNA using HiScript®III RT SuperMix for qPCR (+gDNA Wiper (Vazyme, Nanjing, China). ChamQ SYBR qPCR Master Mix (High ROX Premixed) (Vazyme, Nanjing, China) was applied to detect the expression of HIF1A-AS2 and LAMA, and the mixture was configured according to the instructions of StepOnePlus™ (Thermo Fisher Scientific, Waltham, MA, United States) instrument. The qPCR data were analyzed by StepOne™ software v2.3. The PCR primers were listed in Supplementary Table S1.

TRIzol reagent (Thermo Fisher Scientific, 15596026) was used to extract RNA from HEC-1-A cells. A NanoDrop 2000 (Thermo Fisher Scientific, Inc.) instrument was used to determine RNA concentration. qPCR was performed using the ChamQ™ SYBR^® qPCR Master Mix (High ROX Premixed; Vazyme) based on the manufacturer’s instructions. The relative gene expression was calculated using the 2^−ΔΔCq method [29 (link)]. The primers were the following: β-actin forward, ATGATGATATCGCCGCGCT and reverse AGGATGCCTCTCTTGCTCTG, CLCN4 forward TGATCAGCTCAGCACTTCCA and reverse CATCCTCTCCACAGCCGTAT. Three repetitions of each experiment were performed.

Total RNA was extracted from approximately 30 fly heads using TRIzol Reagent (vazyme, R401-01). The cDNAs were synthesized by reverse transcription using HiScript III All-in-one RT SuperMix (Vazyme, R333), with 1 μg total RNA used as a template for each sample. The cDNA preparation was then subjected to real time quantitative PCR (Applied Biosystem, Step One Real-Time PCR system) according to the protocol of ChamQ SYBR qPCR Master Mix (High ROX Premixed) (Vazyme, Q341). Data analyses were performed using Prism 8.0 (Graphpad). All the primers used are listed in Supplementary Table 1.