Power sybr green and pcr master mix

Two micrograms of total RNA from each sample was treated with one unit of DNase I (Invitrogen) and tested for the absence of genomic DNA by PCR using primers for the rho gene (Table S3). Single-strand cDNA synthesis was performed using the SuperScript III first-strand synthesis kit for RT-PCR (Invitrogen). Quantitative real-time PCR experiments were performed using Power SYBR green and PCR master mix (Applied Biosystems) with the respective primer pairs (Table S3) and the CCNA_02070 gene as a reference control. The reactions were performed in duplicate for each biological replicate in a StepOnePlus real-time PCR system (Thermo Fisher Scientific). The relative change in the expression of each gene was calculated using the 2^-ΔΔCt relative expression quantification method (80 (link)).

Two micrograms of total RNA from each sample was treated with one unit of DNase I (Invitrogen) and tested for the absence of genomic DNA by PCR using primers for the rho gene (Table S3). Single-strand cDNA synthesis was performed using the SuperScript III first-strand synthesis kit for RT-PCR (Invitrogen). Quantitative real-time PCR experiments were performed using Power SYBR green and PCR master mix (Applied Biosystems) with the respective primer pairs (Table S3) and the CCNA_02070 gene as a reference control. The reactions were performed in duplicate for each biological replicate in a StepOnePlus real-time PCR system (Thermo Fisher Scientific). The relative change in the expression of each gene was calculated using the 2^-ΔΔCt relative expression quantification method (80 (link)).

A StepOnePlus Real-time PCR System (ThermoFisher Scientific, Waltham, MA, USA) using Power SYBR Green and PCR Master Mix (ThermoFisher Scientific) was used to examine gene expression of the cyclophilin A in L. mesenteroides EH-1 treated with/without 2 μM TMN355 (Bio-Techne Corporation, Minneapolis, MN, USA). RNA (1 ng) was converted into cDNA using an iScript cDNA Synthesis kit (Bio-Rad, Hercules, CA, USA). cDNA (50 ng/μl) of L. mesenteroides EH-1 was used as a template. Primers were designed using the Primer-Blast tool from the National Center for Biotechnology Information (NCBI). The reaction conditions were set for 40 cycles as follows: 95 °C for 10 min followed by 95 °C for 15 s, 48 °C for 60 s, and 72 °C for 30 s. A complete reaction was achieved with three biological replicates, and each sample consisted of three technical replicates. The gene expression of triosephosphate isomerase (tpi) was used for normalization. The relative expression levels were analyzed using the cycle threshold (2^−ΔΔCt) method. Primers included forward 5′ TCCAAACTAGGATAGCCGCC 3′ and reverse 5′ TTCGTGGCGCTGTTTCAATG 3′ for cyclophilin A; and forward 5′ ACCCTCAGTGGCTCAAGTGG 3′ and reverse 5′ GGCCAGCGTCTGACGTATCA 3′ for tpi.