Cells were first sorted into 5 μl lysis buffer in 96-well plates (CellsDirect Resuspension and Lysis Buffer, Invitrogen) and snap-frozen with dry ice. Right before reverse transcription, samples were heated at 65 °C for 90 s and immediately snap chilled on ice for 5 min. Reaction buffer (1.4 μl) and 0.7 μl enzyme (Maxima First Strand cDNA Synthesis Kit, Thermo Scientific) were added to each sample and reverse transcription was performed with the following protocol: 10 min 25 °C, 15 min 50 °C, 5 min 85 °C. Sequence-specific pre-amplification was performed using TaqMan PreAmp Master Mix (Invitrogen, PN 4391128) by activating the enzyme at 95 °C for 10 min, denaturing at 96 °C for 5 s, then annealing and amplification at 60 °C for 4 min for 20 cycles. Unincorporated primers were inactivated by Exonuclease I by digesting at 37 °C for 30 min and inactivation at 80 °C for 15 min. The resulting complementary DNA was diluted fivefold in DNA Suspension Buffer (10 mM Tris, pH 8.0, 0.1 mM EDTA; TEKnova, PN T0221) before analysis with 2 × Sso Fast EvaGreen Supermix With Low ROX (Bio-Rad Laboratories, PN 172-5211) with nested primers in 48:48 Dynamic Arrays on a Biomark System (Fluidigm). Ct values were calculated from the system’s software (Biomark Real-time PCR analysis, Fluidigm). The list of primers used is shown in Supplementary Methods .
Biomark real time pcr analysis
Manufactured by Standard BioTools
Sourced in United States
The BioMark Real-time PCR Analysis is a lab equipment product that enables real-time PCR (polymerase chain reaction) analysis. It is designed for high-throughput gene expression analysis and digital PCR applications.
Automatically generated - may contain errors
Lab products found in correlation
Biomark system, by Standard BioTools (5 mentions)
Taqman gene expression assay, by Thermo Fisher Scientific (4 mentions)
Biomark hd system, by Standard BioTools (4 mentions)
Taqman preamp master mix, by Thermo Fisher Scientific (2 mentions)
Iscript cdna synthesis kit, by Bio-Rad (2 mentions)
Rnalater, by Qiagen (2 mentions)
Rneasy fibrous tissue mini kit, by Qiagen (2 mentions)
Sybr green master mix, by Takara Bio (2 mentions)
Flex six ifc, by Standard BioTools (2 mentions)
Universal pcr master mix, by Standard BioTools (2 mentions)
Universal pcr master mix, by Thermo Fisher Scientific (2 mentions)
Cellsdirect reaction mix, by Thermo Fisher Scientific (2 mentions)
Ssofast evagreen supermix with low rox, by Bio-Rad (1 mentions)
Dna suspension buffer, by Teknova (1 mentions)
Maxima first strand cdna synthesis kit, by Thermo Fisher Scientific (1 mentions)
Assay loading reagent, by Standard BioTools (1 mentions)
Taqman universal pcr master mix, by Thermo Fisher Scientific (1 mentions)
96.96 dynamic array integrated fluidic circuits chip, by Standard BioTools (1 mentions)
Sample loading reagent, by Standard BioTools (1 mentions)
Cellsdirect 2x reaction mix, by Thermo Fisher Scientific (1 mentions)
13 protocols using biomark real time pcr analysis
1
Single-Cell Gene Expression Profiling
2
Viral Titers and Cytokine Expression
3
Multiplexed Gene Expression Quantification
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Pre-amplification and qPCR were performed as previously described23 , following the guidelines of the manufacturer (Fluidigm, USA). Briefly, samples were submitted to sequence-specific preamplification in a mix containing 1.25 µL assay mix (final concentration of 0.2× for each TaqMan assay), 2.5 µL TaqMan PreAmp Master Mix (Applied Biosystems) and 1.25 µL cDNA. The reactions were initiated at 95 °C for 10 min followed by denaturing at 95ºC for 15 s, annealing and amplification at 60ºC for 4 min for 14 cycles. The preamplified products were diluted sixfold prior to qPCR.
The 96 × 96 Dynamic Array Integrated Fluidic Circuits chip (Fluidigm) was loaded according to the manufacturer's protocol with each sample solution (2.25 µL diluted-preamplified cDNA, 2.5 µL of TaqMan Universal PCR Master Mix [Applied Biosystems] and 0.25 µL of Sample Loading Reagent [Fluidigm, USA]); and each assay solution (2.5 µL of 20 × TaqMan Gene Expression Assay [Applied Biosystems] and 2.5 µL of 2 × Assay Loading Reagent [Fluidigm, USA]). The qPCR thermal cycling was performed in the Biomark HD System (Fluidigm, USA) using the protocol TaqMan GE 96 × 96 Standard. All the analysis was performed in four biological replicates and Ct values were calculated from the system’s software (Biomark Real-time PCR Analysis, Fluidigm, USA).
The 96 × 96 Dynamic Array Integrated Fluidic Circuits chip (Fluidigm) was loaded according to the manufacturer's protocol with each sample solution (2.25 µL diluted-preamplified cDNA, 2.5 µL of TaqMan Universal PCR Master Mix [Applied Biosystems] and 0.25 µL of Sample Loading Reagent [Fluidigm, USA]); and each assay solution (2.5 µL of 20 × TaqMan Gene Expression Assay [Applied Biosystems] and 2.5 µL of 2 × Assay Loading Reagent [Fluidigm, USA]). The qPCR thermal cycling was performed in the Biomark HD System (Fluidigm, USA) using the protocol TaqMan GE 96 × 96 Standard. All the analysis was performed in four biological replicates and Ct values were calculated from the system’s software (Biomark Real-time PCR Analysis, Fluidigm, USA).
4
Single-Cell Gene Expression Profiling
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Equal volumes of each inventoried TaqMan Gene Expression Assay (20X, Applied Biosystem) were pooled and then diluted using TE buffer so that each assay was at a final concentration of 0.2X. These pooled assays were for use in the pre-amplification step. Individual cells were harvested directly into the 10 µL RT-PreAmp Master Mix (5.0 µL CellsDirect 2X Reaction Mix (CellsDirect qRT-PCR kit, Invitrogen); 2.5 µL 0.2X Assay Pool; 0.2 µL RT/Taq Enzyme (CellsDirect qRT-PCR kit, Invitrogen); 2.3 µL Rnase-free water. The harvested single cell samples were immediately frozen and stored at −80°C. Cell lysis and sequence-specific reverse transcription were performed at 50 °C for 20 min. The reverse transcriptase was inactivated by heating to 95 °C for 2 min. Subsequently, in the same tube, cDNA went through sequence-specific amplification by denaturing at 95 °C for 15 s, and annealing at 60 °C for 4 min for 18 cycles. The pre-amplified products were diluted 5-fold and then analyzed by TaqMan PCR. Real-time reactions were performed with Universal PCR Master Mix and inventoried TaqMan Gene Expression Assays (Applied Biosystems) in 48.48 Dynamic Arrays on a BioMark System (Fluidigm). Threshold cycle (Ct) values were calculated from the system’s software (BioMark Real-time PCR Analysis, Fluidigm).
5
Viral Titers and Cytokine Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Organs were kept in RNAlater (Qiagen) after harvesting. RNA was extracted from organ homogenates with the RNeasy Fibrous Tissue Mini Kit (Qiagen), and reverse-transcribed with the iScript cDNA Synthesis kit (Biorad). Viral titers were determined, by qPCR, as absolute levels of the Ie1 gene (F: 5’GAGTCTGGAACCGAAACCGT3’; R: 5’GTCGCTGTTATCATTCCCCAC3’, Sigma) using the SYBR Green Master Mix (Takara). For Il15, Il12 and Il18 gene expression analysis, microfluidic quantitative real-time RT-PCR with the Biomark HD system (Fluidigm) was used. Briefly, pre-amplified cDNA (22 cycles) was diluted fivefold before analysis in a Flex Six IFC (Fluidigm) with Universal PCR Master Mix (Fluidigm) and ready-to-use primer and probe sets pre-developed by Applied Biosystems (TaqMan Gene Expression Assays): IL-15 (Mm00434226_m1), IL-12b (Mm00434174_m1), IL-18 (Mm00434226_m1) and GAPDH as a housekeeper (Mm99999915_g1). Ct values were calculated from the system’s software (BioMark Real-time PCR Analysis; Fluidigm).
6
Single-Cell Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Each assay was performed in replicates. For subsequent analysis, we selected cells and genes as follows: for each gene, inconsistent melting curve, ‘failed' quality control readings and inconsistent expression between replicates was filtered out. Similarly, each cell with failed or inconsistent detection of control genes (TBP and GAPDH) was removed from the analysis. Expression values were deduced from Ct and ΔΔCt values calculated from the system's software (BioMark Real-time PCR Analysis, Fluidigm) using the cellular pool as a sample reference and GAPDH or TBP as reference genes. Data were visualized first by using the R package ‘SINGuLAR Analysis Toolset' developed by Fluidigm. Multidimensional scaling and clustering were conducted using the R software on Euclidian distances or correlation. Heatmaps were generated using the heatmap.2 function of the R package ‘gplots'. To identify differentially expressed genes, we performed a one-way ANOVA, to test for differences in gene expressions among identified cellular subgroups.
7
Single-cell RNA-seq Library Preparation
8
Single-Cell Transcriptome Profiling of Primary Bone Marrow Mesenchymal Stromal Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Primary BM-MNCs were sorted based on the expression of CD271 and CD140a. Linneg/CD45neg/CD271pos/CD140alow/neg and linneg/CD45neg/CD271neg/CD140aneg single cells were sorted directly into lysis buffer containing low EDTA TE buffer (Teknova), NP-40 (Sigma), and SUPERaseIn (Life Technologies). cDNA synthesis of single cells was performed using the qScript cDNA SuperMix Kit (Quanta Bioscience). Specific Target Amplification of 48 genes of interest (genes are listed in Supplementary Table S1 ) was carried out using the TATAA PreAmp GrandMaster Mix Kit (TATAA Biocenter) and the final product underwent exonuclease treatment (Exonuclease I Kit; New England Biolabs). The samples were mixed with EvaGreen Supermix-low ROX (Bio-Rad) and DNA binding dye and loading reagent (both from Fluidigm), loaded onto the 48.48 Dynamic Array IFC chip, and run on the BioMark™ (Fluidigm) system. Data analysis was performed using the BioMark Real-Time PCR Analysis and Singular Analysis Toolset software (Fluidigm). The grouping of the genes as presented in the violin plot analysis was based on published information on gene functions.
9
Single-cell qRT-PCR on BioMark HD System
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Single-cell qRT-PCR was carried out using the BioMark HD System (Fluidigm). Deltagenes assays (Life Technologies) were used at a final concentration of 500 nM for each of the 96 assays. Individual cells were sorted directly into a reverse transcription RT mix solution and spikes (Life Technologies) in a 96-well plate. RNA was denatured and reverse-transcribed. Twenty cycles of preamplification of 96 specific cDNA were performed by denaturing the cDNA at 96°C for 5 seconds, followed by annealing and extension at 60°C for 4 min. Unincorporated primers were cleaned up by Exonuclease I, and the preamplified products were diluted 5-fold. Amplification was performed with Evagreen supermix with low ROX (Bio-Rad) and inventoried DeltaGenes assays in 96.96 Dynamic Arrays on a BioMark HD System (Fluidigm). Cycle threshold (Ct) values were calculated from the system’s software (BioMark Real-Time PCR Analysis, Fluidigm).
10
Quantifying Pluripotency Markers in Embryos
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
All the mouse work was approved by the BRC IACUC (Biopolis). Embryos were derived by crossing of Sox2-GFP heterozygotic females [47 (link)] and males and collected at 3.5 dpc in M2 medium. Total RNA was extracted and purified from the whole embryos using a PicoPure RNA isolation kit (Arcturus Bioscience), and cDNA was synthesized with a high capacity cDNA archive kit (Applied Biosystems; ABI). cDNA was first pre-amplified with a pool of 48 inventoried Taqman assays (20×, Applied Biosystems) by denaturing at 95°C for 15 s and annealing and amplification at 60°C for 4 min for 14 cycles. The pre-amplified products were diluted 5-fold and the expressions of the 48 assays were analyzed with 48/48 Dynamic Arrays on a Biomark System (Fluidigm). Ct values were calculated from the system's software (Biomark Real-time PCR Analysis, Fluidigm). See Supplementary Information for further details of methods and materials part.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!