The largest database of trusted experimental protocols

Mx4000 quantitative pcr system

Manufactured by Agilent Technologies

The Mx4000 quantitative PCR system is a real-time PCR instrument designed for quantitative gene expression analysis. It features a sensitive optical detection system and supports a wide range of fluorescent chemistries for qPCR applications.

Automatically generated - may contain errors

2 protocols using mx4000 quantitative pcr system

1

RNA Extraction and qPCR Analysis Protocol for KGN Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
The TRIzol one-step method (Invitrogen; Thermo Fisher Scientific, Inc.) was used to extract total RNA from KGN cells. Total RNA concentration was detected using a nucleic acid protein analyzer (Beckman Coulter, Inc.). RT was immediately performed using the Prime Script RT-PCR kit (Takara Biotechnology Co., Ltd.) according to the manufacturer's instructions to avoid RNA degradation. qPCR analysis was performed using the quantitative SYBR-Green PCR kit (Qiagen GmbH) and the Mx4000 quantitative PCR system (Stratagene; Agilent Technologies, Inc.). The reaction conditions used for the qPCR were as follows: Initial denaturation for 5 min at 95˚C; followed by 40 cycles of denaturation at 95˚C for 10 sec, annealing at 60˚C for 30 sec and extension at 72˚C for 34 sec. The internal controls used were GAPDH or U6. Gene expression was analyzed using the 2-ΔΔCq method (17 (link)). The primer sequences for PCR were listed as follows: GAPDH forward, 5'-CTTTGGTATCGTGGAAGGACTC-3' and reverse, 5'-GTAGAGGCAGGGATGATGTTCT-3'; U6 forward, 5'-GCTTCGGCAGCACATATACTAAAAT-3' and reverse, 5'-CGCTTCACGAATTTGCGTGTCAT-3'; miR-451a forward, 5'-ACACTCCAGCTGGGAAACCGTTACCATTAC-3' and reverse, 5'-CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGCTTACAG-3; ATF2 forward, 5'-TACAAGTGGTCGTCGG-3' and reverse, 5'-CGGTTACAGGGCAATC-3'; and cyclin D1 forward, 5'-CCGTCCATGCGGAAGATC-3 and reverse, 5'-GAAGACCTCCTCCTCGCACT-3'.
+ Open protocol
+ Expand
2

Quantitative PCR Analysis of Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was harvested (RNeasy Mini Kit; Qiagen), reverse transcribed (SuperScript; Invitrogen/Life Technologies) and subjected to semi-quantitative PCR using primers to ASL (gtggatgttcaaggcagcaaagc and gctcattggctgtgtggatgtcc), IL2Rα (gctctgccactcggaacacaacg and gcagacgctctcagcaggacc) and Tax (cacctgtccagagcatcaga and gggaacattggtgaggaagg). For quantitative PCR reactions, SYBR Green qPCR SuperMix (Invitrogen) was used with mRNA specific primers as listed in Supplemental file 2: Supplementary Table S1. Reactions were performed using an MX4000 quantitative PCR system (Agilent Technologies).
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!