Immunoprecipitation of chromatin was performed according to the Upstate (Millipore) standard protocol. Briefly, 1.2 × 107 BMDMs were fixed using 1% formaldehyde for 10 min at 37 °C, harvested, and sonicated to generate chromatin fragments of 200–500 bp. Then 20 µg of sheared chromatin was immunoprecipitated overnight with 2 µg of anti-Tri-Methyl-Histone H3 (Lys27) (Cell Signaling; 97335), anti-acetyl-H4 (Millipore; 06–866) or anti-EZH2 (Millipore; CS203195) antibody. Immunocomplexes were recovered using 20 µl of protein G magnetic beads, washed, and eluted. Cross-linking was reversed at 65 °C 4 h and immunoprecipitated DNA was recovered using the PCR purification kit from Qiagen. Genomic regions of interest were identified by real-time quantitative PCR (qPCR) using SYBR Green Master Mix (Invitrogen). Each value was corrected by the corresponding input chromatin sample. CXCL9 promoter was amplified using “CCCCGTTGCAATACTTTCAT” (forward) and “CCCCGTTGCAATACTTTCAT” (reverse) primers (EZH2, acetyl-H4) or “TGCTGTTGAATGCCACTTTC” (forward) and “TCCCTGCTACCTTTTCCAGA” (reverse) primers (H3me3). Mouse GAPDH promoter (Diagenode) was amplified as a control.
Anti tri methyl histone h3 lys27
Manufactured by Cell Signaling Technology
Sourced in United States
Anti-Tri-Methyl-Histone H3 (Lys27) is an antibody product offered by Cell Signaling Technology. The antibody specifically recognizes the trimethylated form of histone H3 at lysine 27. This modification is associated with gene repression and plays a role in the regulation of chromatin structure and gene expression.
Automatically generated - may contain errors
Lab products found in correlation
Anti ezh2, by Merck Group (1 mentions)
Anti acetyl h4, by Merck Group (1 mentions)
Sybr green master mix, by Thermo Fisher Scientific (1 mentions)
Pcr purification kit, by Qiagen (1 mentions)
Anti β actin, by Merck Group (1 mentions)
Pvdf membrane, by Merck Group (1 mentions)
Chemiluminescent substrate, by Thermo Fisher Scientific (1 mentions)
Pierce bca protein assay kit, by Thermo Fisher Scientific (1 mentions)
Anti β actin, by GeneTex (1 mentions)
Anti tri methyl histone h3 lys36, by Cell Signaling Technology (1 mentions)
Anti ki67, by Cell Signaling Technology (1 mentions)
N cadherin, by Cell Signaling Technology (1 mentions)
Anti olig2, by Merck Group (1 mentions)
Discovery xt, by Roche (1 mentions)
Ab16667, by Santa Cruz Biotechnology (1 mentions)
Rm2235 microtome, by Leica (1 mentions)
Anti gfap, by Agilent Technologies (1 mentions)
Biotinylated goat anti rabbit igg, by Vector Laboratories (1 mentions)
Mouse on mouse basic kit, by Vector Laboratories (1 mentions)
Anti ha, by Santa Cruz Biotechnology (1 mentions)
5 protocols using anti tri methyl histone h3 lys27
1
Chromatin Immunoprecipitation Assay for Histone Modifications
2
Profiling Epigenetic Repressor Complex
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
PBS-washed cells were lysed and then incubated for 30 min at 4 °C for preparation of whole cell extracts. Determination of protein concentration was performed by utilizing the Pierce™ BCA Protein Assay kit (Thermo Scientific, Rockford, IL, USA). Whole-cell extracts were subjected to SDS-PAGE and then transferred on PVDF membranes (Millipore, Bedford, MA, USA), which were incubated overnight at 4 °C with primary antibodies against anti-EZH2 (1/1000), anti-EED (1/1000), anti-SUZ12 (1/2000), anti-tri-methyl Histone H3 (Lys 27) (1/1000) (Cell Signaling Technology, Boston, MA, USA) and anti-β-actin (1/20,000) (Sigma-Aldrich, Taufkirchen, Germany). The next day, membranes were incubated with the appropriate secondary antibody (Millipore, Bedford, MA, USA). Protein bands were developed using a chemiluminescent substrate (Thermo Scientific, Rockford, IL, USA), and images were obtained with a Vilber FUSION Solo 6X imager (Vilber Lourmat, Collégien, France). Blots were stripped and re-probed with an appropriate antibody. Stripping and re-probing of membranes with anti-β-actin antibody was used to ensure equal protein loading.
3
Comprehensive Antibody Panel for Cell Signaling
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The following primary antibodies were used in the research: anti-FLAG, anti-LDHA, anti-Smad3, anti-phospho-Smad3 (anti-p-Smad3), anti-E-cadherin, anti-N-cadherin, anti-Slug, anti-AMPK, anti-phospho-AMPK (anti-p-AMPK), anti-mTOR, anti-phospho-mTOR (anti-p-mTOR), anti-ULK1, anti-phospho-ULK1 (anti-p-ULK1(Ser 555)), anti-LC3B, anti-p62, anti-cleaved caspase 3, anti-Ki-67, anti-Tri-Methyl-Histone H3 (Lys27), and anti-Tri-Methyl-Histone H3 (Lys36) (Cell Signaling Technology, USA). Anti-β-actin (GeneTex, USA). The LDHA inhibitor FX11 was purchased from Sigma-Aldrich (Darmstadt, Germany). HCQ was purchased from Selleck Chemicals (Houston, USA).
4
Histological Evaluation of Glioma Samples
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Tumor samples fixed in 10% formalin were embedded in paraffin by the Duke Pathology Core and cut into 5-μm–thick sections using a Leica RM2235 microtome. Hematoxylin and eosin (H&E) staining was performed using standard protocols. Tumor grading was done using the following criteria: low-grade glioma (grade II) was indicated by an increased cellular density and the presence of Ki67 + cells; high-grade glioma (grades III and IV) was indicated by the presence of microvascular proliferation and/or the presence of pseudopalisading necrosis. Immunohistochemistry (IHC) was performed using an automated processor (Discovery XT, Ventana Medical Systems, Inc.). Antibodies used were anti-Olig2 (Millipore, #AB9610, 1:500), anti-GFAP (Dako, #Z0334, 1:2,000), anti-Nestin (BD Pharmingen, #556309, 1:200), anti-Ki67 (Abcam #ab16667, 1:200), anti-HA (Santa Cruz Biotechnology, #SC-805, 1:250), and anti–Tri-Methyl-Histone H3 Lys27 (Cell Signaling, #C36B11, 1:200). For rabbit antibodies, 10% normal goat serum in 2% BSA was used for the option/blocking step, and biotinylated goat anti-rabbit IgG (Vector Laboratories, #BA-1000, 1:300) was used for detection. For mouse antibodies, the Mouse on Mouse Basic Kit (Mouse on Mouse, Vector Laboratories, #BMK-2202) was used as directed for the option/blocking and detection steps.
5
Immunodetection of Extracellular Vesicle Markers
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Primary antibodies were used at 1–2 μg·ml−1 for immunoblotting, 2 μg·ml−1 for immunofluorescence, and 1–10 μg·ml−1 for MELC. The following antibodies were used for immunostaining, flow cytometry, or immunoblotting: anti-ADAM10 (mouse monoclonal, ab73402; Abcam), anti-CD63 (mouse monoclonal, 556019; BD Biosciences), anti-CD81 (mouse monoclonal, 555675; BD Biosciences), anti-haptoglobin (rabbit polyclonal, GTX 112962-25; Biozol), and anti-trimethyl histone H3 Lys27 (rabbit monoclonal, #9733; Cell Signalling). The following secondary antibodies were used: Alexa Fluor 488 goat anti-mouse and Alexa Fluor 555 goat anti-rabbit IgG (both from Life Technologies) and anti-mouse IgG-HRP conjugate and anti-rabbit IgG-HRP conjugate (both from Cell Signalling).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!