Site-directed mutants of EcPutA were made from the full-length construct of wild-type EcPutA (UniProt Accession ID:P09546) (EcPutA-pET14b) using Stratagene QuikChange or Invitrogen GeneTailor mutagenesis kits. The primers used for mutagenesis were purchased from Integrated DNA technologies and are listed in Table S1 (see Supporting Information ). C-terminal deletion mutants were generated by inserting a stop codon immediately after the codons for residues 1308, 1314, and 1317. All of the EcPutA mutants were confirmed by DNA sequencing. EcPutA wild-type and mutant proteins were overexpressed in E. coli strain BL21(DE3) pLysS and purified by Ni-NTA Superflow affinity (Qiagen) chromatography using a N-terminal 6xHis-tag as previously described.50 (link),53 (link) The N-terminal His-tag was retained for EcPutA wild-type and mutants in subsequent experiments. Purified proteins were stored in 50 mM Tris buffer containing 50 mM NaCl, 0.5 mM EDTA, 0.5 mM Tris (3-hydroxypropyl) phosphine (THP), and 10% glycerol (pH 7.5).
Quikchange
Manufactured by Thermo Fisher Scientific
The QuikChange is a site-directed mutagenesis kit designed for rapid and efficient introduction of point mutations, deletions, and insertions into double-stranded plasmid DNA. The kit provides a simple and reliable method for creating specific DNA sequence changes without the need for subcloning.
Automatically generated - may contain errors
Lab products found in correlation
3 protocols using quikchange
1
Preparation of EcPutA Mutants
2
Construction of Genetic Constructs for SecA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Strains and plasmids were constructed using standard methods (48 , 49 ). A list of all the strains and plasmids used in this study can be found in Table S1 in the supplemental material. An amber (TAG) codon was introduced at codon 796 of the secA gene in plasmids pDH625 (His-SUMO-SecA) and pDH545 (Strep-SUMO-SecA) using QuikChange (Invitrogen). Variants of secA under the control of an IPTG-inducible promoter were introduced onto the chromosome using λInCh (50 (link)). pDH733 was constructed by ligating annealed oligonucleotide SecMArrest-for (CATGGGAGACCGGTCCCGGGAGCTCTTCAGCACGCCCGTCTGGATAAGCCAGGCGCAAGGCATCCGTGCTGGCCCTT) and SecMArrest-rev (CCGGAAGGGCCAGCACGGATGCCTTGCGCCTGGCTTATCCAGACGGGCGTGCTGAAGAGCTCCCGGGACCGGTCTCC) and ligating them into plasmid pHK771 (51 (link)) cut with NcoI and BspEI. Derivatives of pDH733 were constructed by amplifying the fragment encoding the corresponding portion of SecM or MBP and ligating it into pDH733 cut with NcoI and SacI. Strep-SUMO-SecM-expressing plasmids were constructed by amplifying the SecM-encoding region from the corresponding pDH733 derivative and cloning it into pCA597 cut with BsaI and BamHI.
3
Cloning and mutagenesis of BrxR protein
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
PCR amplicons and plasmids were purified using Monarch DNA kits (NEB). PCR, restriction digests, ligations, transformations and agarose gel electrophoresis were performed using standard molecular biology techniques. Constructed plasmids were confirmed via sequencing with an Abi 3370 DNA sequencer. The pSAT1-LIC-brxR+ expression construct adds a cleavable N-terminal His6-SUMO tag. Primers TRB878 and TRB879 were used to amplify brxR from pEFER (gene pEFER_0020) for insertion into pSAT1-LIC (38 (link)) to produce pTRB446 via Ligation Independent Cloning (LIC) (Supplementary Table S1 ). Primers TRB876 and TRB877 were used to amplify brxR from pEFER which was inserted into pBAD30 (39 (link)) to produce pBAD30-his6-brxR (Supplementary Table S1 ). Primers TRB1987 and TRB1988 were used to perform QuikChange (Invitrogen) mutagenesis to produce pBAD30-his6-brxR-R17A (Supplementary Table S1 ).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!