Ddk myc tags

Manufactured by OriGene

Sourced in Italy

DDK-Myc tags are a set of protein tags designed for protein expression and purification. The tags consist of a Dykdadka (DDK) epitope and a c-Myc epitope, which can be used for detecting and purifying recombinant proteins in various applications.

Automatically generated - may contain errors

Lab products found in correlation

Pcmv6 entry etv7, by OriGene (2 mentions) Pcmv6 entry empty, by OriGene (1 mentions) Prl sv40, by Promega (1 mentions) Q5 high fidelity dna polymerase, by New England Biolabs (1 mentions)

2 protocols using ddk myc tags

Cloning and Characterization of DNAJC15 Promoter

Check if the same lab product or an alternative is used in the 5 most similar protocols

The expression vectors pCMV6-Entry-Empty, pCMV6-Entry-ETV7 and pCMV6-Entry-DNAJC15 C-terminally tagged with DDK-Myc tags were purchased from Origene (Tema Ricerca, Bologna, Italy).
pGL4.26-DNAJC15 reporter was obtained by cloning the promoter region of DNAJC15 (−299 to +512 bp from TSS according to the Eukaryotic Promoter Database, http://epd.vital-it.ch/) amplified with Q5 High Fidelity DNA Polymerase (New England Biolabs, Euroclone, Milan, Italy) and the following primers (Eurofins Genomics): Fw: GCCTCGAGCAGCACAAACTCATTTGAGGG and Rv: GCAAGCTTAGGCGGCCCGGAGACTCAAG. Purified PCR product was inserted into pGL4.26 backbone using Xho I and Hind III restriction endonucleases. Cloning was checked by restriction analysis and direct sequencing (Eurofins Genomics). For site-directed mutagenesis of this vector please refer to the section below. The pRL-SV40 (Promega) vector constitutively expressing the Renilla reniformis luciferase cDNA was used as transfection efficiency control for gene reporter assays.

Alessandrini F., Pezzè L., Menendez D., Resnick M.A, & Ciribilli Y. (2018). ETV7-Mediated DNAJC15 Repression Leads to Doxorubicin Resistance in Breast Cancer Cells. Neoplasia (New York, N.Y.), 20(8), 857-870.

+ Open protocol

+ Expand

Lentiviral Vector Cloning of ETV7

Check if the same lab product or an alternative is used in the 5 most similar protocols

The expression vector pCMV6-Entry-ETV7 C-terminally tagged with DDK-Myc tags was purchased from Origene (Tema Ricerca, Bologna, Italy). The lentiviral vector pAIP-ETV7 was obtained by cloning using the following primers to amplify the ETV7 gene from pCMV6-Entry-ETV7 and inserting it into the pAIP-Empty plasmid (the tails containing restriction endonucleases’ target sequences are indicated in lowercase):
Fw: aggttaacATGCAGGAGGGAGAATTGGCTA
Rv: gagaattcTTAAACCTTATCGTCGTCATCC
pAIP was a gift from Jeremy Luban (Addgene plasmid #74171; http://n2t.net/addgene:74171; Watertown, MA, USA). Purified PCR product was inserted into the pAIP backbone using HpaI and EcoRI restriction endonucleases (New England Biolabs, Euroclone, Milan, Italy). Correct cloning was checked by restriction analysis and direct sequencing (Eurofins Genomics).
pCMV-D8.91 and pCMV-VSVg plasmids for lentiviral particles production were obtained from Prof. Anna Cereseto, Laboratory of Molecular Virology, CIBIO Department, University of Trento, Italy.

Pezzè L., Meškytė E.M., Forcato M., Pontalti S., Badowska K.A., Rizzotto D., Skvortsova I.I., Bicciato S, & Ciribilli Y. (2021). ETV7 regulates breast cancer stem-like cell features by repressing IFN-response genes. Cell Death & Disease, 12(8), 742.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!