Sybr green mix

Total RNA was extracted from the cultured cells using TRIzol Reagent (Invitrogen) according to the manufacturer's instructions. For relative quantification RT-PCR analysis of Tip60, MDM2, and GAPDH mRNA, 1 μg of total RNA was reverse-transcribed to cDNA with oligo d(T) using RevertAid H Minus First Strand cDNA Synthesis Kit (Thermo Scientific). cDNA were amplified by real-time PCR on an RotorGene 6000 PCR machine (Qiagene) using SYBR green mix (BioLine). All reactions were run in triplicate. Data were analysed by RotorGene 6000 Series Software. Relative amounts of Tip60 and MDM2 mRNAs were normalized to GAPDH mRNA. Expression of these genes was analysed by RT-PCR using the following primers: (Tip60) F-ttttccccagaatggagccg, R-gtggtgctgacggtattcca; (MDM2) F- tgggcagcttgaagcagttg, R-caggctgccatgtgacctaaga; (GAPDH) F-gggaag gtgaagg tcggagt, R-ttgaggtcaatgaaggggtca.

Total RNA was extracted from liver samples using TRIzol (Invitrogen, Bleiswijk, the Netherlands), and was reverse transcribed with the iScript cDNA Synthesis Kit (Bio-Rad, Veenendaal, the Netherlands). The expression of target genes was measured quantitatively by real-time PCR using SYBR Green mix (Bioline, London, U.K.). All primer sets used are listed in Supplementary Table S1. mRNA expression levels were normalized to two reference genes (cyclophilin A and β2-microglobulin), and data were analyzed with the ΔCT method^{61 (link)}. Data are expressed as normalized gene expression levels relative to wild-type RAGE+/+LeptrDb+/+mice.

RNA was isolated from 25–30 embryos of each condition from the same experiment using Trizol according to manufacturer’s protocol. 500 ng isolated RNA was reverse transcribed via First Strand Maxima Synthesis kit (ThermoFisher). RT-qPCR was performed using SYBR Green Mix (Bioline) with previously tested primers on a BioRAD CFX Connect. Tests were run in duplicates of at least three independent experiments. Expression was normalized to Elongation factor 1 alpha expression. S1 Table shows the list of studied genes and used primer pairs.

Real‐time quantitative PCR (qPCR) was performed using a Corbett Rotorgene and SYBR green mix (Bioline). qPCR was performed in triplicate for each sample and quantified using a standard curve. Histone modification data [(IP—no antibody control)/input] were expressed as a percentage of the input and normalized to levels of histone H3 at each amplified region. Data are presented as averages of ≥ 2 biologically independent experiments, with error bars representing the standard error of the mean.

4 μg of extracted RNA was incubated (37°C, 1 h) with 2 μL DNase I buffer, 1 μL RNaseOUT (Invitrogen), 6 μL H₂0, 1 μL DNase I (Roche) then heated (70°C, 15 min). 0.5 μg RNA was reverse transcribed by incubating (65°C, 5 min) with 0.6 μL random primers, 1 μL dNTPs in a 13 μL final volume and then adding 4 μL First-Strand buffer, 1 μL 0.1 M DTT, 1 μL RNaseOUT, 1 μL Superscript III (replaced with 1 μL H₂0 in control reactions) and incubating at 50°C (1 h) and then 70°C (15 min). Complementary DNA (cDNA) levels for each gene were analyzed by Real Time quantitative PCR (qPCR) using a RotorGene (Corbett), SYBR Green mix (Bioline) and primers. Transcript levels in each sample were normalized to the level of the ADH1 transcript for the comparison between BY4741 and paf1Δ samples as this gene is not Paf1-enriched or depleted in YPD. Transcript levels in each sample were normalized to the level of the CLB1 transcript for the comparison between BY4741 in YPD and BY4741 after 60 min in YPG samples as the level of Paf1 on Pol2 at this gene does not change between these two conditions. The mean transcript level or nuclear/total transcript level was then calculated across all replicates. Error bars show the SEM. See Table S5 for primers used in qPCR.

The qPCR reactions were performed using a Realplex Real-Time PCR system (Eppendorf, Germany) and SYBR Green mix (Bioline) in 96 well optical reaction plates (Axygen, USA) sealed with ultra-clear sealing film (Platemax). The reactions were performed in a 10 μl total volume containing 5 μl of 2x SensiMix SYBR No ROX mix (Bioline), 400 nM of each primer, 1.0 μl of diluted cDNA and nuclease-free water. The reaction conditions were 95°C for 2 min, followed by 40 cycles of 15 s at 95°C and 30 s at 62°C with fluorescent signal recording. After amplification, melt curves were generated for each reaction to ensure specific amplification. All qPCR reactions, including the non-template control, were performed in biological and technical triplicates. The mean values obtained from the nine values (triplicates of each biological triplicate) were used to calculate the final quantification cycle values (Cq).