Fv1000 confocal microscopy

A HITACHI F-4500 fluorescence spectrophotometer was obtained from Hitachi, Ltd. (Tokyo, Japan). Bruker Tensor 27 spectrometer was obtained from Bruker Corporation (Karlsruhe, Germany). Bruker micro TOF-Q II ESI-TOF LC/MS/MS spectroscopy was obtained from Bruker Corporation (Karlsruhe, Germany). Varian INOVA-400 MHz spectrometer (400 MHz) was obtained from Varian, Inc. (Palo Alto, CA, USA). Spectra max190-Molecular Devices was obtained from Molecular Devices Corporation (Sunnyvale, CA, USA) and Olympus FV1000 confocal microscopy was obtained from Olympus Corporation (Tokyo, Japan).

The oligonucleotide-modified probe sequences for circNUP214 and miR-125a-3p were synthesized by GenePharma (GenePharma, Suzhou, China). The fresh CD4⁺ T cell suspension was pipetted onto autoclaved glass slides. The probes and SA-CY3 were proportioned to prepare the probe mixture. Then, hybridization was performed at 37°C overnight in a dark environment. After washing thrice with 20× SCC/–hybridization buffer for 5 min, the slides were incubated with DAPI for 20 min. Images were acquired using fluorescence microscopy (OLYMPUS FV1000 confocal microscopy, Japan). The probe sequences were as follows: circNUP214: 5’ – TGATCGAGACAGGCTGGCCCATGGCTGTAGAAGGGGT - 3’, miR-125a-3p: 5’ - GGCTCCCAAGAACCTCACCTGT - 3’.

All chemicals were of analytical-reagent grade, and they were commercially available from commercial sources and used without further purification. The SGC-7901 living cells (human gastric carcinoma cells) were obtained from Xi'an Jiaotong University Health Science Center. The twice-distilled water was used throughout the experiment. The solid powders of probes BOS1/BOS2 were dissolved in ethanol solution in concentration of 1 mM as stock solutions. And then took out quantificational BOS1/BOS2 in different testing systems. Fluorescence spectra were carried on a HITACHI F-4500 fluorescence spectrophotometer. UV-vis spectra were performed on a Shimadzu UV-1700 spectrophotometer. The elemental analyses of C, H, and N were performed on a Vario EL III elemental analyzer. IR spectra were recorded on a Bruker Tensor 27 spectrometer. NMR spectra were obtained on a Varian INOVA-400 MHz spectrometer (at 100 MHz for ¹³C NMR and 400 MHz for ¹H NMR). A Bruker micro TOF-Q II ESI-TOF LC/MS/MS Spectroscopy was used to perform mass spectra. Melting point tests were taken on an XT-4 micromelting apparatus and uncorrected. Results of cytotoxicity were analyzed with the Soft max pro software (version 2.2.1) in Spectra max190-Molecular Devices. The living cells imaging were performed on an Olympus FV1000 confocal microscopy with λ_ex = 400 nm.

HEK-293 cells were cultured in 24-well plates containing glass slides and serum-starved overnight. Serum-starved Nc-1 tachyzoites were inoculated into the cells or not at a MOI of 10 for 10 min. For parasite immunofluorescence, purified Nc-1 tachyzoites were fixed on coverslips coated with polylysine. Coverslips were rinsed in 1× PBS with 0.05% Tween-20. Monolayers were fixed with 4% paraformaldehyde for 15 min, washed three times in PBST and permeabilized in cold 0.25% Triton X-100 (Life Technologies Corporation, CA, United States) for 10 min. After PBST washing, coverslips were blocked in 5% w/v bovine serum albumin (BSA) for 1 h at 37°C. Slides were incubated in the mAb against phospho-tyrosine 1068 EGFR and EGFR (1/1,000) or antiserum against NcSAG1 (1/100) in PBST containing 3% BSA for 1 h at 37°C. After washing three times in PBST, slides were incubated with the corresponding secondary antibody conjugated to Cy3 or FITC (1/500) in PBST containing 3% BSA for 45 min in the dark. Slides were washed three times in PBST and counter stained with DAPI (1/1,000; GeneCopoeia, United States) for 5 min. After washing, monolayers were then observed using a FV1000 confocal microscopy (Olympus Co., Japan). Specificity of staining was determined by incubating monolayers with secondary antibody only.

Microscopy experiments were performed as described previously (Bayram et al., 2019 (link)). Strains expressing sGFP were grown in Lab-Tek chambered Coverglass W/CVT (Thermo Scientific, 155360) in 400 μl GMM with required supplements for 16 h at 25 °C. DRAQ5 (Sigma) with 1:10,000 dilution was used for nuclear staining 30 min prior to imaging under microscope. Microscopic images were captured using the Olympus FV1000 confocal microscopy in 60x magnification.

Tg(mpeg1.1:eGFP) and zbtb14^-/-//Tg(mpeg1.1:eGFP) larvae were collected at 48 hpf and fixed in 4% paraformaldehyde. The fixed larvae were incubated with primary rabbit anti-phospho-histone H3 (pH3; Upstate Biotechnology) and goat anti-GFP (Abcam) antibodies according to the manufacturer’s protocol and subsequently stained with Alexa Fluor-647 anti-rabbit and Alexa Fluor-488 anti-goat secondary antibodies (Invitrogen). TUNEL assays were performed using the In Situ Cell Death Detection Kit and TMR Red (Roche Diagnostics) according to the manufacturer’s recommendations. Images were taken using Olympus FV 1000 confocal microscopy equipped with the FV10-ASW version 3 software.

Frozen muscle sections were fixed in 4% paraformaldehyde and permeabilized in 0.5% Triton X-100 for 10 min. Sections were incubated with mouse IgG-blocking solution from the M.O.M kit (Vector Lab, Burlingame, CA, USA) according to the manufacturer's protocol. Primary and secondary antibodies were as following: Desmin (1 : 200, Santa Cruz, Dallas, TX, USA), dystrophin (1 : 200, Sigma-Aldrich), Laminin (1 : 500, Sigma-Aldrich), MF20 (1 : 10, DSHB), Pax7 (1 : 100, DSHB), eMHC (1 : 200, DSHB), BA-F18 (1 : 2, DSHB), BAD5 (1 : 2, DSHB), and Rabbit anti β-galactosidase (1 : 500, Sigma-Aldrich). FITC-conjugated F4/80 and CD11b (eBiosciences, San Diego, CA, USA) were used for staining macrophage markers in cardiotoxin injured TA muscles. All secondary antibodies were obtained from Invitrogen (Carlsbad, CA, USA) and used at 1 : 500 dilutions. Pictures were taken with a Nikon TE2000 epifluorescent microscope with deconvolution (Volocity; Perkin-Elmer, Waltham, MA, USA) or an Olympus FV1000 confocal microscopy (FV1000, Olympus, Center Valley, PA, USA).