Total RNA from mouse hepatic and intestinal tissues or from Caco-2 cells was isolated using the TriPure reagent (Roche, Switzerland). cDNA was obtained by reverse transcription of 1 μg of total RNA using the Goscript RT Mix OligoDT kit (Promega, the Netherlands). Real-time qPCR was performed with a CFX96 TouchTM instrument and software (Biorad, USA) using SYBR Green (Eurogentec, Belgium) for detection. All samples were run in duplicate in a single 96-well reaction plate, and data were analysed according to the 2−ΔΔCT method. The purity of the amplified product was verified by analysing the melt curve performed at the end of amplification. The ribosomal protein L4 (Rpl4) was chosen as reference gene for all mouse tissues. The primer sequences for the targeted mouse genes are detailed in Table S1 . The 18S ribosomal RNA (18S rRNA) was chosen as reference gene for human cell analyses. The primer sequences for the targeted human genes are detailed in Table S2 .
Cfx96 touch instrument
Manufactured by Bio-Rad
Sourced in United States, China, Japan
The CFX96 Touch instrument is a real-time PCR detection system designed for quantitative gene expression analysis and genotyping. It features a 96-well sample block and utilizes a high-performance optical system to provide sensitive and reliable fluorescence detection.
Automatically generated - may contain errors
Lab products found in correlation
Trizol reagent, by Thermo Fisher Scientific (6 mentions)
Trizol, by Thermo Fisher Scientific (5 mentions)
Spss 16.0 software program, by IBM (2 mentions)
Gdna eraser kit, by Takara Bio (2 mentions)
Tb premix ex taq 2, by Takara Bio (2 mentions)
Primescript rt reagent, by Takara Bio (2 mentions)
Gycogen, by Thermo Fisher Scientific (2 mentions)
Kapa sybr fast, by Roche (2 mentions)
Viia7 real time pcr instrument, by Thermo Fisher Scientific (2 mentions)
Superscript 2 reverse transcriptase, by Thermo Fisher Scientific (2 mentions)
Ssoadvanced universal probe supermix, by Bio-Rad (2 mentions)
Mulv reverse transcriptase, by Thermo Fisher Scientific (2 mentions)
Revertaid first strand cdna synthesis kit, by Thermo Fisher Scientific (2 mentions)
Nanodrop 2000, by Thermo Fisher Scientific (2 mentions)
Sybr green, by Eurogentec (1 mentions)
Goscript rt mix oligodt kit, by Promega (1 mentions)
Tripure reagent, by Roche (1 mentions)
Gotaq rt qpcr system, by Promega (1 mentions)
Biorad cfx 96, by Bio-Rad (1 mentions)
Omega fungal rna kit, by Omega Bio-Tek (1 mentions)
33 protocols using cfx96 touch instrument
1
Quantifying Gene Expression in Mouse and Human Cells
2
Functional Profiling of miRNAs and lncRNAs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To predict the functions of the miRNAs and lncRNAs, the target genes and differentially expressed genes were annotated against the NCBI non-redundant protein database (Nr), the Gene Ontology (GO) database, Kyoto Encyclopedia of Genes and Genomes (KEGG), and clusters of orthologous groups of proteins. GO terms with KS ≤0.05 and pathways with corrected P ≤0.05 were de ned as signi cantly enriched.
Quantitative real-time PCR analysis of miRNA and lncRNA
In the present study, 8 miRNAs and 7 lncRNAs were veri ed by using quantitative real-time PCR (qRT-PCR). The primers for miRNA and lncRNA are shown in Additional le 13. Total RNA of ovaries and testis was extracted by TRIzol reagent (Invitrogen, USA) strictly followed the manufacturer's instructions. Using total RNA from the ovaries and testes of turtles as a template, rst-strand cDNAs of miRNAs were obtained with a Mir-X miRNA rst strand synthesis kit (Clontech, USA). Expression pro les of miRNAs were examined by SYBR qRT-PCR (Clontech). All reactions were performed in a CFX96 Touch TM instrument (Bio-Rad, USA).
All experiments were repeated at least three times. The results of the qRT-PCR data are presented as the mean ± standard error of the mean value. Statistical analyses were performed using the SPSS 16.0 software program (SPSS Inc., Chicago, IL, USA). Differences were considered statistically signi cant at P < 0.05.
Quantitative real-time PCR analysis of miRNA and lncRNA
In the present study, 8 miRNAs and 7 lncRNAs were veri ed by using quantitative real-time PCR (qRT-PCR). The primers for miRNA and lncRNA are shown in Additional le 13. Total RNA of ovaries and testis was extracted by TRIzol reagent (Invitrogen, USA) strictly followed the manufacturer's instructions. Using total RNA from the ovaries and testes of turtles as a template, rst-strand cDNAs of miRNAs were obtained with a Mir-X miRNA rst strand synthesis kit (Clontech, USA). Expression pro les of miRNAs were examined by SYBR qRT-PCR (Clontech). All reactions were performed in a CFX96 Touch TM instrument (Bio-Rad, USA).
All experiments were repeated at least three times. The results of the qRT-PCR data are presented as the mean ± standard error of the mean value. Statistical analyses were performed using the SPSS 16.0 software program (SPSS Inc., Chicago, IL, USA). Differences were considered statistically signi cant at P < 0.05.
3
Quantitative RT-qPCR for ZIKV Detection
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Entire female mosquitoes and eggs used as experimental samples were processed for RNA extraction with Trizol (Invitrogen, Carlsbad, California, USA) and mechanical maceration, as instructed by the manufacturer. Reverse transcription was performed together with quantitative one-step PCR (GoTaq® RT-qPCR Systems, Promega, Madison, Wisconsin, USA), following the manufacturer’s instructions. qPCR assay for ZIKV was performed with primers set (5’-GTGTAAACCCTTGGGAGGTTT-3’ forward and 5’-AAGTTGGTAGCAAAGGAGATGGC-3’ reverse). Standard curve used was from CprM-ZIKV Gene Fragments dilutions, ranging 300,000 to 3 copies. All tests were performed in triplicate. BIO-RAD CFX96 touch instrument was used (BIO-RAD, Hercules, Califórnia, EUA), following the manufacturer’s instructions.
4
Validating Gene Expression Profiles by qRT-PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To confirm the reliability of the gene expression data, quantitative reverse transcription-PCR (qRT-PCR) was conducted for 20 genes involved in sugar or lipid metabolism under different temperature treatments. The primers used for qRT-PCR are listed in S1 Table . The total RNA was extracted using the Omega fungal RNA kit (Omega Bio-Tek, Georgia, USA) according to the manufacturer’s instructions. A total 1 μg of the extracted RNA was reverse-transcribed into cDNA using PrimeScript™ RT reagent with the gDNA Eraser kit (TaKaRa, Dalian, China) following the manufacturer’s instructions. The gene expression levels were determined by qRT-PCR on a Bio-rad CFX96 Touch instrument (Bio-Rad, USA) using TB Premix Ex Taq II (TaKaRa) according to the manufacturer’s instructions. The histone H1 gene was used as the reference gene in qRT-PCR analysis. Data were analyzed using Bio-rad CFX96 software and the 2-ΔΔCT method [23 (link)].
5
Quantitative Expression Analysis of GATA Transcription Factor in Aspergillus oryzae
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted using an Omega plant RNA kit (Omega Bio-Tek, Georgia, USA) according to the manufacturer’s instructions. One microgram of RNA was reverse-transcribed into cDNA using PrimeScript™ RT reagent with the gDNA Eraser kit (TaKaRa, Dalian, China). A. oryzae GATA TF primers were designed using the Primer-BLAST tool (https://www.ncbi.nlm.nih.gov/tools/primer-blast ) (Additional file 2 : Table S2). Gene expression levels were determined by perfoming qRT-PCR on a Bio-rad CFX96 Touch instrument (Bio-Rad, USA) using TB Premix Ex Taq II (TaKaRa) according to the manufacturer's instructions. Data were analyzed using Bio-rad CFX96 software and the method (Livak and Schmittgen 2001 (link)). The histone H1 gene was used as the reference gene in qRT-PCR analysis.
6
Bacterial RNA Extraction and RT-PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The total RNA of bacteria was extracted using RNApure Bacteria Kit (CWBIO, Beijing, China) according to the manufacturer’s instructions and quantified using a Nanodrop spectrometer. Reverse transcription of extracted RNA was performed using the EasyQuick RT MasterMix (CWBIO, Beijing, China) following the manufacturer’s protocol. Primers used are listed in Table S2 . RT-PCR analysis was performed using a Bio-Rad CFX96 touch instrument (Bio-Rad, Hercules, CA, USA) with UltraSYBR mixture (CWBIO, Beijing, China) under the following program: predenaturation step at 95 °C for 30 s, 40 cycles of denaturation for 5 s at 95 °C, primer annealing for 30 s at 60 °C. The relative gene expression was calculated using a 2−ΔΔCT method [33 (link)].
7
Quantification of Cytokine Gene Expression in Post-Booster PBMC
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The PBMC were collected on the third day post-booster immunization from different groups (n = 20/group) and analyzed for IFN-γ and IL-4 mRNA expression by quantitative real time PCR as per previous method (Nang et al., 2011 (link)) using the published primers (Table 1 ) (Nang et al., 2011 (link); Fan et al., 2013 (link)). Briefly, the total RNA isolated from PBMC was used for the preparation of cDNA employing Revertaid First Strand cDNA Synthesis Kit (Thermo Scientific, Waltham, MA), following the manufacturer's instructions. Quantification of the above mentioned immune genes were done by USB VeriQuest SYBR Green qPCR Master Mix (2X) with β-actin as the house keeping gene in CFX96 Touch instrument (Bio-Rad, Hercules, CA) in triplicates. The data of quantitative real time PCR were analyzed by the 2−ΔΔCt method (Livak and Schmittgen, 2001 (link)) to derive the fold change in mRNA expression relative to the control group (PBS).Table 1
List of primers used for quantification of cytokine gene transcripts by real time RT-qPCR.
| Sl.No | Gene | Primer sequence (5′to 3′) | Reference |
|---|---|---|---|
| 1 | IFN-γ | F: TGAGCCAGATTGTTTCGATG | Nang et al., 2011 (link) |
| 2 | IL-4 | F: GGAGAGCATCCGGATAGTGA | Nang et al., 2011 (link) |
| 3 | β-actin | F:TATGTGCAAGGCCGGTTT | Fan et al., 2013 (link) |
8
Quantitative Real-Time PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNAs were extracted from three independent pools of ≈30 7dpf larvae using RNeasy Plus Mini Kit (Qiagen). The iScript Reverse Transcription Supermix (Bio-Rad Laboratories, Mississauga, Canada) was used to reverse transcribe 1 µg of total RNA. The cDNA equivalent of ≈133 ng total RNA was analyzed in triplicate by quantitative Real Time-PCR using the SsoAdvanced SybrGreen PCR mix and a CFX96 touch instrument (Bio-Rad). Cycling conditions: Polymerase activation and cDNA denaturation (one cycle: 98 °C for 30 s); 40 cycles of denaturation for 10 s at 98 °C; 20 s annealing/extension at 60 °C. All experiments included a melt curve analysis of PCR amplicons generated by ramping from 65 to 95 °C in 0.5 °C increments for 5 s/step. Raw cycle threshold values (Ct-values) were exported from the CFX Manager Software (Bio-Rad, Canada), and the relative gene expression was calculated using the Relative Expression Software Tool (REST-2009)86 (link). The statistical significance was tested by a Pair Wise Fixed Reallocation Randomization Test©. Gene information and primer sequences are listed in Supplementary Table 4 . The size of amplification products was <150 bp.
9
SARS-CoV-2 Molecular Diagnosis by RT-PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Molecular diagnosis of SARS-CoV-2 was performed by amplification and detection of target sequences in the ORF1ab and N genes using the Detection Kit for 2019 Novel Coronavirus (2019-nCoV) RNA (PCR-Fluorescence Probing) (Da An Gene Co., Ltd. of Sun Yat-sen University. Cat. # D-930) according to the manufacturer's protocol. In brief, 5 μL of extracted RNA was added directly to 20 μL of the reaction mixture. Each reaction mixture contained 17 μL of PCR solution A (specific primers, probes, and TRIS-HCl buffer) and 3 μL of solution B (hot start Taq DNA polymerase, c-MMLV reverse transcriptase). RT-PCR assays were performed using a CFX96 Touch instrument (Bio-Rad, CA, UDA), with the following reaction conditions: a cDNA synthesis step at 50 °C for 15 min, initial denaturation at 95 °C for 15 min, followed by 45 amplification cycles of 94 °C for 15 s and 55 °C for 45 s. The cycle threshold (CT) was determined using the CFX Maestro Software (Bio-Rad). A CT value ≤ 40 was considered detected/positive, and a CT value > 40 was considered negative. For each assay, a negative and positive control was included.
10
Gene Expression Analysis of LPS-Induced Inflammation in BV2 Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
BV2 cells or transfected cells were treated with diverse concentrations (1, 3, and 10 μM) of VSP-2 or Ros (Ros, 1 μM) for 12 h after LPS (0.1 μg/mL) stimulation for 24 h. Total RNA was obtained using Trizol reagent (TIANGEN Biotech, China). Reverse transcription was performed using RTIII Super Mix with dsDNase kit (Mona Biotech, China). Quantitative real-time PCR was performed using MonAmp™ SYBR® Green qPCR Mix (Mona Biotech, China) and a CFX96 Touch instrument (BioRad, USA). The gene expressions were calculated by 2−ΔΔCt method [28 (link)] and normalized to the internal control GAPDH.
The primer sequences were as followed:
GAPDH, F: 5′-AGGTCGGTGTGAACGGATTTG-3′
R: 5′-GGGGTCGTTGATGGCAACA-3′
IL-1β, F: 5′-AACTCAACTGTGAAATGCCACC-3′,
R: 5′-CATCAGGACAGCCCAGGTC-3′
IL-6, F: 5′-TACTCGGCAAACCTAGTGCG-3′
R: 5′-GTGTCCCAACATTCATATTGTCAGT-3′
TNF-α, F: 5′-CACCACGCTCTTCTGTCTACTG-3′
R: 5′-GCTACAGGCTTGTCACTCGAA-3′
PPARγ, F: 5′-CAAGCCCTTTACCACAGTTGA-3′
R: 5′-CAGGTTCTACTTTGATCGCACTT-3′
The primer sequences were as followed:
GAPDH, F: 5′-AGGTCGGTGTGAACGGATTTG-3′
R: 5′-GGGGTCGTTGATGGCAACA-3′
IL-1β, F: 5′-AACTCAACTGTGAAATGCCACC-3′,
R: 5′-CATCAGGACAGCCCAGGTC-3′
IL-6, F: 5′-TACTCGGCAAACCTAGTGCG-3′
R: 5′-GTGTCCCAACATTCATATTGTCAGT-3′
TNF-α, F: 5′-CACCACGCTCTTCTGTCTACTG-3′
R: 5′-GCTACAGGCTTGTCACTCGAA-3′
PPARγ, F: 5′-CAAGCCCTTTACCACAGTTGA-3′
R: 5′-CAGGTTCTACTTTGATCGCACTT-3′
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!