Ms salt

Germination assay was performed using 60 seeds of the WT and OE-VIP1–4, 5, 6 lines (identical storage condition). Seeds were surface sterilized and plated on 0.8% agar (Sigma) containing MS salts (Sigma) and 3% (w/v) sucrose with or without ABA. Plated seeds were then chilled at 4°C in darkness for 3 d, and finally germinated at 22°C in 16 h light/8 h darkness. After 4 days, germination rates were scored based on emergence of the radical through the seed coat. This experiment was repeated three times.
For ABA sensitivity and PEG tolerance analyses, seeds of WT and OE-VIP1–4, 5, 6 lines were germinated on MS medium for 3 d, and then transferred to normal medium or medium contained ABA or PEG. Root lengths of seedlings grown in 16 h light/8 h darkness were recorded after 14 d. For drought tolerance analyses, three-week-old plants in soil were withheld from watering for 21 d and then were re-watered at the 21^st day of drought. Observations were recorded after 3 d or 5 d of re-watering.

Col-0 (WT), SALK_013909.27.65 (arpc4), SALK_123936.4 (arpc5), SALK_099449, SAIL_1210_A03C1 and SAIL_131_F01 (arpc3) T-DNA insertion mutant lines were obtained from The Nottingham Arabidopsis Stock Centre (NASC). The arpc4 (SALK_013909.27.65), arpc5 (SALK_123936.4) and arpc2 lines were already characterized in previous research produced in our laboratory^{25 (link),29 (link)} as were the complemented lines GFP:ARPC2 and ARPC5:mCherry³² . Plants were grown under a 16 h-light/8 h-dark cycle (light intensity 110 mmol/m²/s) at 22 °C either on peat pellets or in vitro. For in vitro cultures, seeds were briefly washed with 96% ethanol and then surface-sterilized by bleach solution (sodium hypochlorite solution at the final concentration of 2.5%) for ten minutes, they were sown on half-strength Murashige and Skoog (MS) medium (1% [w/v] sucrose, 2.2 g/l MS salts [Sigma/Aldrich], 0.8% agarose, [pH 5.7]).

Nicotianatobacum cv Bright Yellow 2 (BY-2) cells were cultured in media containing 0.43% [w/v] Murashige and Skoog (MS) salts (Sigma-Aldrich, USA), 1 mg/L thiamine, 0.2 mg/L 2,4-D, 100 mg/L Myo-inositol, 0.255 g/L KH₂PO₄, and 3% [w/v] sucrose (pH = 5.8). They were put in an orbital shaker at 130 rpm at 26 °C in the dark. After 3-4 days of cultivation, the cells were used for the following experiments. The seeds of Arabidopsis thaliana were sterilized for 10 min in 1.5% NaClO solution. Sterile arabidopsis seeds were then rinsed 5 times with sterile water and placed on MS growth-medium without or with LDH-lactate-NS (10, 25, 50, and 100 μg/mL) for germination and growth. Sterile petri dishes were used for all germination and growth experiments and placed into the growth chamber at 22 °C and 16/8 hours day/night rhythm.

Experiments were carried out using A. thaliana accession Col-0 as the wild-type background. The crtW over-expressors were obtained exploiting Agrobacterium tumefaciens-mediated transformation of the 35S:PLS-crtW construct in Col-0, following the floral dip protocol (Clough and Bent, 1998 (link)). Transgenic seedlings were selected for resistance on kanamycin and subsequently verified by PCR for the presence of the transgene with the following primers: attB1 (GGGACAAGTTTGTACAAAAAAGCAGGCT) and PLS_crtW_Rv (TCAGGCGGTATCACCCTTAGT). Soil-grown plants were cultivated at 23°C day/18°C night under neutral day photoperiod (12-h light:12-h darkness) in single 6 cm pots using a 3:1 soil: perlite mixture (with HAWITA tray substrate), after seed vernalization at 4°C in the dark and germinated. The quantum irradiance was 80- to 100-μmol photons m⁻² s⁻¹. For the in vitro selection of transformed plants, seeds were surface sterilized using 70% (v/v) ethanol and 10% (v/v) commercial bleach solution and then rinsed 5–7 times with sterile distilled water. Seeds were then sown on solid sterile 1/2 strength Murashige–Skoog (MS) medium [0.215% (w/v) MS salts (Sigma-Aldrich), 0.8% agar (w/v), 0.5% (w/v) sucrose, pH 5.7]. Genomic DNA was extracted following the protocol described by Edwards et al. (1991) (link).

A. thaliana natural accessions used in this study were obtained from the Arabidopsis Biological Resource Center (Ohio, USA). A. lyrata seed was provided by O. Savolainen (Oulu, Finland). The co-1-mutant line that is introgressed in Col-0 was provided by G. Coupland (Koln, Germany). The FRI Sf2 line carrying the FRI locus that is introgressed from Sf2 into Col-0, and the FRI Sf2 co-1 line carrying the FRI locus from Sf2 and the co-1 mutation were provided by R. Amasino (Madison, USA).
Plants were grown under continuous fluorescent light, long-day (14L:10D) or short-day (10L:14D) conditions at 21 °C on Metromix 360 soil (SUNGRO Horticulture, USA). For screening transgenic plants, plants were grown under continuous fluorescent light on 1.0% (w/v) agar plates containing MS salts (Sigma), 2% sucrose and 50 μg ml⁻¹ kanamycin after sterilization of the surface of the seeds.

Seeds were surface sterilized for 5 min in 10% bleach, 0.1% Triton X-100, then washed three times with sterile double distilled H₂O. Seeds were stratified at 4° for 2 days to synchronize germination. For time-lapse imaging on the confocal microscope (treatments and wound responses), sterile seeds were sown directly onto glass-bottom petri dishes (ref 627861 from Greiner (Germany), and ref 3930–035 from Iwaki (Japan)) against a block of ½ Murashige and Skoog medium (2.17 g MS salts per litre (Sigma)) at pH 5.7 solidified with 1% bacto-agar (Appleton Woods; as shown in Supplementary Fig. 9). Seedlings were grown under continuous light (100 μE m⁻² s⁻¹). For all other experiments (mechanical stress, bulk up and gene expression), sterile seeds were sown onto round or square petri dishes containing MS agar media as described above.

Fruit pericarp was manually removed and the seeds were desinfested according to Oliveira et al. (2013) and germinated in a medium
composed of MS salts (Sigma) PageBreakand vitamins (Murashige and Skoog 1962 ), 30 g L^-1 sucrose (Sigma), 7 g
L^-1 agar and 2.685 µM naphthaleneacetic acid (NAA, Sigma).
Solanumlycopersicum and
Pisumsativum seeds were subjected to the
same disinfestation procedure and inoculated in medium without NAA. Germination was
done at 25 °C under a 16/8 hours (light/dark) regime.