Anion exchange columns

The cDNA encoding the COX2 ORF was amplified by PCR using primers incorporating restriction enzyme sites (Hind III and XbaI) from NCBI online. The PCR fragment was cloned into the digested plasmids of pcDNA3.1 leading to the production of pcDNA3.1-COX2, with the following primers: COX2-sense: 5′- TATAAGCTTCCCTCAGACAGC AAAGCCTA-3′ and COX2-antisense: 5′- CTAGTCTAGA CTACAGTTCAGTCGAACGTTCTTTTAG-3′. Plasmids were isolated and purified using anion exchange columns (QIAGEN, Hilden, Germany) and all constructs were sequenced. Cells were transfected using Lipofectamine2000 reagent (Invitrogen) according to the protocol from the manufacturer.

A bicistronic expression and Gateway-compatible destination vector (pTRIP.CMV.IVSb.GENE.ires.TagRFP) for lentiviruses was kindly provided by Charles Rice, The Rockefeller University, USA. To generate chIFIT5 entry clone, gene encoding chIFIT5 was PCR amplified with oligonucleotides (Supplementary Table 1) containing attB sites flanking gene-specific sequences. PCR products were purified over Qiagen columns (Qiagen) and cloned into pDONR (Invitrogen) with BP Clonase. BP Clonase reactions were transformed into Escherichia coli (Invitrogen), and colonies were screened by restriction digestion and sequencing. The gene sequences from pENTR clones were moved into pTRIP.CMV.IVSb.GENE.ires.TagRFP using LR Clonase II (Invitrogen) according to the manufacturer’s instructions. After LR reaction products transformation, one or two colonies for each construct were grown in 3 ml Luria-Bertani (LB) broth with ampicillin, and transfection-quality plasmid DNA was purified over anion-exchange columns (Qiagen). Lentivirus constructs expressing human IFIT1, IFIT2, IFIT3, IFIT5, IRF1 (positive control) and ffluc (negative control) were kindly provided by Charles Rice, The Rockefeller University, USA. All constructs were sequenced using primers provided in Supplementary Table 1 to confirm the gene insertion before rescuing lentiviruses.