RNA was extracted using Trizol (Invitrogen, Carlsbad, CA). Total RNA (1 μg) was reverse-transcribed using Revert Aid™ First Strand cDNA Synthesis Kit (Fermentas, Pittsburgh PA, USA). PGRMC1 (Forward: CCATCAACGGCAAGGTG; Reverse: GGGCAGCAGTGAGGTCAG), CCND2 (Forward: ACAGAAGTGCGAAGAAGAGGT; Reverse: ATGGAGTTGTCGGTGTAAATG), p450scc (Forward: GGAGAAGCTCGGCAACG; Reverse: AGGGCGGGATGAGGAAT), CYP19a (Forward: TGTTGAAGAGGCAATAATAAAGG; Reverse: CCAAGTCCACGACAGGCT) and GAPDH (Forward: GTGAAGCAGGCGTCGGA; Reverse: AGGTGGAGGAGTGGGTGTC) were measured using a real-time PCR kit (Roche, Basel, Switzerland). The target gene mRNA was determined in triplicate in three to six separate experiments and normalized to GAPDH. qRT-PCR Assays-on-Demand for PGRMC1, CCND2, p450scc, CYP19a and GAPDH were performed in the ABI 7500 Fast (PE Applied Biosystems) using relative quantification. Analysis and fold differences were determined using the comparative cycle threshold (CT) method. Fold change was calculated from the ΔΔCT values with the formula 2−ΔΔCT, and data are presented as relative to expression in control cells.
Real time pcr kit
Manufactured by Roche
Sourced in Germany
Real-time PCR kits are laboratory equipment used for the amplification and detection of specific DNA or RNA sequences in a sample. These kits include the necessary reagents and consumables required to perform the real-time polymerase chain reaction (PCR) process, which allows for the quantification of target nucleic acids in real-time.
Automatically generated - may contain errors
Lab products found in correlation
Trizol, by Thermo Fisher Scientific (3 mentions)
Trizol reagent, by Thermo Fisher Scientific (2 mentions)
Rpmi 1640 medium, by Thermo Fisher Scientific (2 mentions)
Airway epithelial cell growth medium, by PromoCell (2 mentions)
Opti mem 1 reduced serum medium, by Thermo Fisher Scientific (2 mentions)
Lipofectamine 2000, by Thermo Fisher Scientific (2 mentions)
Revertaid first strand cdna synthesis kit, by Thermo Fisher Scientific (1 mentions)
Abi 7500 fast, by Thermo Fisher Scientific (1 mentions)
M mlv reverse transcriptase kit, by Takara Bio (1 mentions)
Lightcycler 480 system, by Roche (1 mentions)
Iq5 real time pcr detection system, by Bio-Rad (1 mentions)
Rnaiso plus reagent, by Takara Bio (1 mentions)
Interleukin 4 (il 4), by Merck Group (1 mentions)
Foetal bovine serum (fbs), by Cytiva (1 mentions)
Fetal bovine serum (fbs), by Cytiva (1 mentions)
Tunicamycin, by Merck Group (1 mentions)
4 phenylbutyric acid 4 pba, by Merck Group (1 mentions)
β actin, by Abcam (1 mentions)
Control sirna, by Thermo Fisher Scientific (1 mentions)
Ly294002, by Beyotime (1 mentions)
11 protocols using real time pcr kit
1
Gene Expression Analysis of Steroidogenic Factors
2
Quantitative Analysis of Soybean Circadian Genes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated from the WT and T2 mutant soybean leaves using TRIzol reagent (Invitrogen, Shanghai, China). The cDNA synthesis was conducted using an M-MLV reverse transcriptase kit (Takara, Dalian, China) according to the manufacturer’s instructions. The qRT-PCR analysis was used to measure the transcript levels of the GmLHY genes, namely GmGA1, GmGA2, GmCPS2, GmGR2, GmGR8, and GmDW1, on a Roche LightCycler480 system (Roche, Germany) using a real-time PCR kit (Roche, Germany). The soybean housekeeping gene GmTubllin (Glyma.05G157300) was used as an internal reference to normalize all data. The relative transcript level of the target gene was calculated using the 2−ΔΔCT method. Three biological replications per line were performed in each test.
3
Comprehensive Liver and Renal Assessment
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Laboratory tests involved liver and renal function tests, blood lipids, fasting blood glucose, and virological factors. Liver and renal function tests (ALT, aspartate aminotransferase [AST], alkaline phosphatase [ALP], γ-glutamyl transferase [GGT], albumin, total bilirubin, urea, creatinine, uric acid, and estimated glomerular filtration rate [eGFR]), blood lipids (total cholesterol, triglyceride, HDL-cholesterol, and low-density lipoprotein [LDL]-cholesterol) and fasting blood glucose were tested with an automated clinical chemistry analyzer (Roche Cobas 8000; Basel, Switzerland). The ULN of ALT was defined as 40 U/L according to the APASL guidelines [4 (link)]. HBsAg and HBeAg levels were determined by chemiluminescent assay (Kemei Biological Technology Co., Ltd., Beijing, China). The hepatitis B virus deoxyribonucleic acid (HBV DNA) level was measured by a real-time PCR kit with a lower detection limit of 20 IU/mL (Roche Diagnostics, Penzberg, Germany) or with a lower detection limit of 100 IU/mL (Tianlong Technology Co., Ltd., Xi’an, China).
4
Real-Time PCR Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Briefly, total RNA was extracted with Trizol reagent (Invitrogen, Carlsbad, CA) and reverse transcribed into cDNA with an real-time PCR kit (Roche, Basel, Switzerland) according to manufacturer's instructions. Real-time PCR was performed with cDNA equivalent to 200 ng of total RNA on a Bio-Rad iQ5 Real-Time PCR Detection System (Bio-Rad Laboratories). Cycling conditions were as follows, 95°C for 2 min, followed by 40 cycles of 95°C for 10 s, 60°C for 30 s, and 95°C for 10 s. GAPDH was used as an endogenous control. PCR results were normalized to GAPDH expression and were quantified by the ΔΔCT method. The sense and antisense primers used in this study are listed in Table 1 . All primers were synthesized by Sangon Biotech. Co., Ltd. (Shanghai, China).
5
Quantifying miR-34a and Gene Expression in Cell Lines
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNAs were extracted from BM, spleen, purified DC, or 293T cells by using RNAiso Plus reagent (TAKARA Biotechnology Co.LTD, DALIAN). To detect miR-34a expression, total RNAs were reversed using MMLV reverse transcriptase with miR-34a specific RT primer 5′-CTCA ACTG GTGT CGTG GAGT CGGC AAT TCA GTT GAG ACA ACC AG-3′. The resultant cDNA was then used as template to perform real time PCR using a Roche real time PCR kit with specific PCR primers: F: 5′-ACA CTC CAG CTG GG TGG CAG TGT CTT AGC T -3′, R: 5′-CTC AAC TGG TGT CGT GGA-3′. To detect the expression of other genes, total RNAs were reversed using MMLV reverse transcriptase with Oligo (dT). Transcripts were quantified by real time PCR and normalized to the amount of GAPDH mRNA expression. The PCR primers are listed in Supplemental Table 1 .
6
Transcriptional Profiling of Immune Cell Subsets
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNAs were extracted from different tissues (BM, thymus, and spleen) and purified cells, including single-positive T cells (CD4+, CD8+), DP (CD4+CD8+), DN (CD4−CD8−), CLP, preproB, immature B, and recirculating B cells, or 293T cells using RNAiso Plus reagent (TAKARA Biotechnology Co. Ltd., Dalian, China). To detect miR-128-2 expression, total RNAs were reversed using MMLV reverse transcriptase with miR-128-2 specific RT primer 5′-CTC AAC TGG TGT CGT GGA GTC GGC AAT TCA GTT GAG AAA GAG AC-3′. The resultant cDNA was then used as a template to perform real-time PCR using a Roche real-time PCR kit with specific PCR primers: F: 5′-AAC ACT CCA GCT GGG TCA CAG TGA ACC GGT CT-3′, R: 5′-CTC AAC TGG TGT CGT GGA-3′. To detect the expression of other genes including BMI-1, SZRD1, AFF4, A2B, and MALT1, total RNAs were reversed using MMLV reverse transcriptase with Oligo (dT). Transcripts were quantified by real-time PCR and normalized to the amount of GAPDH mRNA expression. The PCR primers are listed in Supplementary Table 1 .
7
LXA4 and IL-4 Modulate Nasal Epithelial Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
LXA4 and IL-4 were obtained from Millipore (Burlington, MA, USA). Primary human nasal epithelial (NHNE) cells and airway epithelial cell growth medium were purchased from PromoCell (Heidelberg, Germany). RPMI 1640 medium and TRIzol were purchased from Invitrogen (Carlsbad, CA, USA). Real-time PCR kits were obtained from Roche Applied Science (Mannheim, Germany). A 21-nucleotide sequence siRNA corresponding to the human FPR1 sequence (5′-AGAAAUUGGUAUUGCAGUGUU-3′) were purchased from Bioneer (Daejeon, South Korea). Primary and secondary antibodies targeting MUC5AC and MUC5B (used in immunoassays) were obtained from Santa Cruz Biotechnology (Santa Cruz, CA, USA). Antibodies against p38, extracellular signal-regulated kinase (ERK), JNK, and phospho-p38 were from Cell Signaling Technology (Danvers, MA, USA). Foetal bovine serum (FBS) was purchased from Hyclone Laboratories (Logan, UT, USA). This study was approved by the Institutional Review Board of Konkuk University Medical Center (Seoul, Republic of Korea; approval no. KUH-1110016).
8
Modulation of ER Stress in Nasal Epithelial Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Tunicamycin (an ER stress inducer) and 4-phenylbutyric acid (4-PBA, an ER stress inhibitor) were obtained from Sigma-Aldrich (St. Louis, MO, USA). Primary human nasal epithelial cells (HNEpCs) and airway epithelial cell growth medium were purchased from PromoCell (Heidelberg, Germany). RPMI 1640 medium and Trizol were from Invitrogen (Carlsbad, CA, USA). EZ-Cytox Cell Viability Assay kits were purchased from Daeil Laboratories (Seoul, Korea). Reverse transcriptase-polymerase chain reaction (RT-PCR) kits were from Applied Biosystems (Foster City, CA, USA). Real-time PCR kits were obtained from Roche Applied Science (Mannheim, Germany). Primary and secondary antibodies for MUC5AC and MUC5B (used immunoassay) were obtained from Santa Cruz Biotechnology (Santa Cruz, CA, USA). For Western blot analysis, primary and secondary antibodies of XBP-1, CCAAT-enhancer-binding protein homologous protein (CHOP), ATF6 and β-actin were purchased from Abcam (Cambridge, MA, USA). Fetal bovine serum (FBS) was purchased from Hyclone Laboratories (Logan, UT, USA). OPTI-MEM I Reduced Serum Medium, Lipofectamine 2000, predesigned small interfering RNAs (siRNAs) targeting XBP-1, CHOP, and ATF6, and control siRNA were purchased from Thermo Fisher Scientific (Lafayette, CO, USA). This study was approved by the Institutional Review Board of Yeungnam University Medical Center (IRB No. YUMC 2015-06-058).
9
Molecular Pathway Modulation Protocols
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Atorvastatin (Ator) and 3-aminobenzoate methanesulfonate salt (MS-222) were supplied by Sigma (St Louis, MO, USA). Sodium tanshinone IIA sulfonate (STS) was purchased from Chengdu MUST Biotechnology (Chengdu, China), and the purity is HPLC ≥ 92%. The real-time PCR kits were from Roche Life Science (Mannheim, Germany). LY294002, Wortmannin, U0126, Rapamycin, FR 180204, SP600125, and SB239063 were purchased from Beyotime Technology (Shanghai, China). Akt inhibitor IV was obtained from Calbiochem (Darmstadt, Germany). All the chemicals were dissolved in dimethylsulfoxide (DMSO).
10
Comprehensive Liver Function Assessment
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The liver function tests including levels of total protein (TP), albumin, alkaline phosphatase (ALP), aspartate aminotransferase (AST), alanine aminotransferase (ALT), γ-glutamyl transferase (GGT), and total bilirubin (TB) were measured using the commercially available kits (MyBioSource, Inc. CA, USA). The HV serology markers were measured by the chemiluminescent microparticle immunoassay method (Abbott Diagnostics, IL, USA) and serum levels of HBV DNA and HCV RNA were measured by the real-time PCR kits (Roche Diagnostics, IN, USA) according to the manufacturer’s protocols.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!