Total RNA was extracted from the tumor metastases and SK-OV-3 cells using the RNeasy Mini Kit (Qiagen) according to the manufacturer’s protocol. One microgram of total RNA was converted to cDNA using Superscript II reverse transcriptase (Invitrogen, Carlsbad, CA, USA) and oligo-(dT)12–18 primers (Invitrogen) according to the manufacturer’s instructions. reversetranscription quantitative polymerase chain reaction (RT-qPCR) was performed in a 20 µl reaction mixture, containing 1 µL cDNA, 10 µl SYBR Premix EX Taq (Takara Bio, Otsu, Japan), 0.4 µL Rox reference dye (50×, Takara Bio), and 200 nM primers for each gene. The primer sequences were: SLC6A12 (forward), 5’-CCTGGCCACTTTCCTCTTCTC-3’; SLC6A12 (reverse), 5’-CAGGAACCAGCCAATGGAGTA-3’; GAPDH (forward), 5’-AATCCCATCACCATCTTCCA-3’; and GAPDH (reverse), 5’-TGGACTCCACGACGT ACTCA-3’. The reactions were run on a 7500 Fast Real-Time PCR System (Applied Biosystems, Foster City, CA, USA) at 95℃ for 30 sec, followed by 40 cycles of 95℃ for 3 sec and 60℃ for 30 sec, and a single cycle of 95℃ for 15 sec, 60℃ for 60 sec, and 95℃ for 15 sec to generate dissociation curves. All PCR reactions were performed in triplicate, and the specificity of the reaction was determined by melting curve analysis. Comparative quantification of each target gene was performed based on cycle threshold (Ct) normalized to GAPDH using the ΔΔCt method.
Rox reference dye 50
Manufactured by Takara Bio
Sourced in China, Japan
ROX Reference Dye (50×) is a concentrated solution of a fluorescent dye that can be used as a passive reference in real-time PCR experiments. It is designed to provide a stable fluorescent signal that can be used to normalize the target signal, improving the accuracy and precision of quantitative results.
Automatically generated - may contain errors
Lab products found in correlation
Sybr premix ex taq, by Takara Bio (3 mentions)
7500 fast real time pcr system, by Thermo Fisher Scientific (2 mentions)
Sybr primer ex taqii, by Takara Bio (2 mentions)
Sybr premix ex taq 2 tli rnaseh plus, by Takara Bio (2 mentions)
Sybr premix ex taq 2, by Takara Bio (2 mentions)
Rneasy mini kit, by Qiagen (1 mentions)
Superscript 2 reverse transcriptase, by Thermo Fisher Scientific (1 mentions)
Oligo dt 12 18 primer, by Thermo Fisher Scientific (1 mentions)
Trizol reagent, by Thermo Fisher Scientific (1 mentions)
Abi 7900ht fast real time pcr system, by Thermo Fisher Scientific (1 mentions)
Sybr premix ex taq 2 2, by Takara Bio (1 mentions)
Uv 2550, by Shimadzu (1 mentions)
Abi prism 7000 real time pcr detection system, by Thermo Fisher Scientific (1 mentions)
Transcriptor first strand cdna synthesis kit, by Takara Bio (1 mentions)
Trizol reagent, by BioTeke (1 mentions)
Primescript rt reagent kit with gdna eraser, by Takara Bio (1 mentions)
Trizol reagent, by Beyotime (1 mentions)
Rnase free water, by Takara Bio (1 mentions)
Lightcycler 480, by Roche (1 mentions)
Cdna synthesis kit, by Takara Bio (1 mentions)
10 protocols using rox reference dye 50
1
Quantification of SLC6A12 Expression in Ovarian Cancer
2
Quantification of Gene Expression by qPCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Mouse pancreas and liver were homogenized in TRIzol Reagent (Life Technologies, USA, 15596026) prior to RNA extraction, and PCR primers were designed using Primer 5.0. qPCR and amplification were performed by the ABI 7900HT fast real-time PCR system (Applied Biosystems, USA). The reaction mixture contained 10 μl of SYBR® Primer EX Taq II (Takara, Japan, RR420A), 0.4 μl ROX reference dye (50×) (Takara, Japan, RR420A), 1.0 μl DNA template, and 0.8 μl of each of the primers (final concentration was 0.4 μM), with 7 μl Milli-Q H2O. The qPCR condition was as follows: start at 95°C for 10 min, followed by 40 cycles of degeneration at 95°C for 30 s, annealing at 60°C for 30 s, and extension at 72°C for 30 s. Relative levels (fold change) of the target genes were normalized against a housekeeping gene (GAPDH) and analyzed by the 2−(△△Ct) method (for specific primers, see Table 1 ).
3
Validating Differential Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Selected DEGs were validated using a qPCR approach using primers synthesized by Invitrogen Biotechnology Co., Ltd. (Shanghai, China) as compiled in Supplementary Table S1 . To ensure the specificity of amplification reactions, standard curves and melt curves were generated for all primer pairs. GAPDH served as a reference control gene. Each 20 μL qPCR reaction contained 10 μL of SYBR® Premix Ex Taq (Tli RNaseH Plus) (2×) (TaKaRa Biotechnology Co., Ltd., Dalian, China), 0.4 μL of forward and reverse primers, 0.4 μL of ROX Reference Dye (50×) (TaKaRa), 2 μL of cDNA, and 6.8 μL of distilled water. Thermocycler settings were 95°C for 30 s; 40 cycles of 95°C for 5 s, 60°C for 30 s. Relative gene expression was assessed via the 2−ΔΔCt method. Samples were analyzed in triplicate and averaged together to quantify gene expression.
4
Quantitative Real-Time PCR Analysis of MeFtsZ Genes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The relative mRNA expressions of MeFtsZs were analyzed by quantitative real-time RT-PCR (qRT-PCR) using the qRT-PCR primers shown in Table 1 . The qRT-PCR primers for each MeFtsZ gene were designed for the region of low sequence similarity to the other genes to ensure their specificity. The reactions were performed in a 384-well plate in a volume of 10 μL containing 4 μL of template cDNA, 0.4 μL of H2O, 5 μL of 2× SYBR® Premix Ex Taq II (Tli RNaseH Plus), 0.4 μL of forward and reverse primers (10 μM) and 0.2 of μL ROX Reference Dye (50×) (SYBR green reagents were supplied by Takara, Dalian, China). The PCR thermocycler program was as follows: 1 min at 95 °C for one cycle, 45 cycles of 5 s at 95 °C, and 30 s at 60 °C, and melting curve analysis at 95 °C for 15 s, 60 °C for 15 s, and 95 °C for 15 s. Cassava tubulin gene (Phytozome name: 4.1_007598m.g) mRNA was amplified as an internal control to calculate the relative expression using the 2−ΔΔCt method. Three technical replicates were analyzed for each biological sample.
5
Soil Dehydrogenase and Bacterial Biomass Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The soil dehydrogenase (DHA) activity was measured by monitoring the rate of the reduction of triphenyl tetrazolium chloride (TTC) to triphenyl formazan (TPF), as described by Oliveira et al.37 (link), with some modifications. TPF was detected using a spectrophotometer (UV-2550, Shimadzu) at 485 nm after a dark incubation for 24 h and expressed in μg TPF d·g−1 of dry soil 24 h−1.
The bacterial biomass was analysed using the real-time PCR of the 16S rRNA gene; this was performed with the ABI Prism 7000 Real-Time PCR Detection System (Applied Biosystems, USA) using SYBR Premix Ex Taq II (2×) and ROX Reference Dye (50×) (Takara, China). A standard curve was produced using genomic DNA extracted from E. coli. as a template to quantify the total number of bacterial 16S rRNA gene copies. The primers used for amplification of the 16S rRNA genes were 8F (5′-GAGAGTTTGATCCTGGCTCAG-3′) and 518R (5′-ATTACCGCGGCTGCTGG-3′). The conditions for the real-time PCR were 30 s at 95 °C and then 40 cycles of 95 °C for 15 s, 55 °C for 30 s, 72 °C for 45 s and 72 °C for 5 min.
The bacterial biomass was analysed using the real-time PCR of the 16S rRNA gene; this was performed with the ABI Prism 7000 Real-Time PCR Detection System (Applied Biosystems, USA) using SYBR Premix Ex Taq II (2×) and ROX Reference Dye (50×) (Takara, China). A standard curve was produced using genomic DNA extracted from E. coli. as a template to quantify the total number of bacterial 16S rRNA gene copies. The primers used for amplification of the 16S rRNA genes were 8F (5′-GAGAGTTTGATCCTGGCTCAG-3′) and 518R (5′-ATTACCGCGGCTGCTGG-3′). The conditions for the real-time PCR were 30 s at 95 °C and then 40 cycles of 95 °C for 15 s, 55 °C for 30 s, 72 °C for 45 s and 72 °C for 5 min.
6
RT-PCR Analysis of C3 Gene Expression in Bovine Tissues
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated from heart, liver, spleen, lung, kidney, and mammary tissues from six Chinese Holstein cattle (three healthy samples and three diseased samples with clinical mastitis) using TRIzol reagent (Bioteke, Beijing, China) in accordance with the manufacturer’s instructions. cDNA was synthesized with the transcriptor first-strand cDNA synthesis kit (TaKaRa, Dalian, China). RT-PCR analysis was performed using a 20 μl mixture containing 50 ng of cDNA, 0.4 μM of sense and antisense primers, 6.8 μl of dH2O, 10.0 μl of SYBR® Premix Ex Taq™ (2×), and 0.4 μl of ROX Reference Dye (50×) (TaKaRa, Dalian, China). To normalize differences in the amount of total cDNA added to each reaction, the reaction mixture was denatured for 30 s at 95°C and incubated for 40 cycles (denaturing for 5 s at 95°C, annealing for 31 s at 60°C).
The primers used in the experiment based on C3 (accession NO. NM_001040469.2) were as follows:F: GAGATTCTGGCCGTGAGCTTG , R: GATCGCTCGGATCTCCACTTG . The PCR was monitored by the ABI PRISM 7000HT Fast Real-Time PCR system. The relative quantification of the C3 gene expression was calculated using the standard curve-based method for relative RT-PCR.
The primers used in the experiment based on C3 (accession NO. NM_001040469.2) were as follows:
7
Quantification of CARD9 Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total cellular RNA was isolated with TRIzol reagent (Beyotime) following the manufacturers’ instructions. Equal amounts of RNA (1 μg) were used as template to synthesize first-strand cDNA with the PrimeScript RT reagent Kit with gDNA Eraser (Takara, Dalian, China). Then each PCR reac-tion contained a total volume of 20 μL SYBR Premix Ex Taq (2 μL cDNA, 0.4 μL of each specific primer, 0.4 μL of ROX Reference Dye [50×], 10 μL SYBR Premix Ex Taq, and 6.8 μL RNase free water, Takara) was performed with an Applied Biosystems 7500 Fast Real-Time PCR System (Foster City, CA, USA) at the following conditions: 95℃ for 30 seconds, 40 cycles at 95℃ for 15 seconds, and 60℃ for 30 seconds. β-actin was used as an internal control to normalize the expression of target gene. The PCR reaction for each sample was done in triplicate and the experiments were performed for 3 times. The relative quantity of target gene expression was calculated according to 2-ΔΔCT method. Primers used in this study were as follows: CARD9: F, ATGTCGGACTACGAGAACGAT; R, TGATGCGTGAGGGGTCGAT; β-actin: F, GTGGACATCCGCAAAGAC; R, AAAGGGTGTAACGCAACTA.
8
qRT-PCR Analysis of miRNA Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Eight miRNAs were selected for qRT-PCR using gene-specific primers and universal reverse primers and U6 was used as the internal control33 (link) (Supplementary Table S1 ). The stem-loop primer was used for miRNA reverse transcription; qRT-PCR forward primer and universal reverse primer were used to amplify miRNA sequences. Reverse transcription of miRNA was carried out using the cDNA Synthesis Kit (TaKaRa, China). The qRT-PCR experiments were conducted on Roche Lightcycler 480 (Roche, USA). The reactions were carried out in a total volume of 20 μl containing 2 μl of diluted cDNA, 0.8 μl of each primer, 0.4 μl ROX Reference Dye (50×) (TaKaRa, China), 6 μl sterile distilled water and 10 μl SYBR Premix Ex Taq II (TaKaRa, China) with the following cycling profile: 95 ℃ for 3 min, followed by 45 cycles at 95 ℃ for 15 s, 60 ℃ for 30 s. Three independent biological replicates were performed. All of the measurements were made in triplicate. The relative expression levels were calculated using 2−△△Ct method.
9
cDNA Synthesis and Real-Time PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Complementary DNA (cDNA) was synthesized from TRIzol-isolated total RNA using a SuperScript III First Strand Synthesis SuperMix for quantitative reverse transcription–PCR (Takara). For real-time PCR experiments, reactions containing SYBR Premix EX Taq (Takara), ROX Reference Dye (50×; Takara), cDNA, and gene primers were run on a StepOnePlus real-time PCR system and analyzed using StepOne Software, version 2.1 (Applied Biosystems). Gene primers are available upon request from the corresponding author. Relative gene quantification was calculated by the method and then normalized to the level of GAPDH (25 (link)).
10
Gut Microbiome DNA Extraction and qPCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The genomic DNA of intestinal contents and fecal samples were extracted using the bead-beating method (Li et al., 2014a) . The qPCR amplification was performed using an ABI 7900HT fast real-time PCR system (Applied Biosystems, Carlsbad, CA) and the reaction of qPCR assays contained 10 μL of SYBR Primer EX TaqII (Takara, Dalian, China), 0.4 μL of ROX Reference Dye (50×; Takara), 1.0 μL of DNA template, and 0.8 μL of each of the primers (the final concentration was 0.4 μM) with 7 μL of milli-Q H 2 O (Millipore, Billerica, MA). The amplification was programed to start at 95°C for 30 s, followed by 40 cycles (degeneration at 95°C for 5 s, annealing at 60°C for 30 s; Wang et al., 2014) . The relative population (fold change) of the target bacterial was analyzed using the 2 -ΔΔCt method based on qPCR data according to Feng et al. (2010) . Different groups and species of bacteria targeted by primers are listed in Table 2.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!