Escherichia coli dh5α cells

Purified plasmid DNA was obtained from overnight 50-mL LB liquid broth cultures of K. pneumoniae isolates. Plasmid extraction was performed using the PureYield plasmid midiprep system (Promega Italia Srl). Plasmid DNA was transformed into chemically competent Escherichia coli DH5-α cells (Life Technologies, Thermo Fisher Scientific, Waltham, MA, USA), selecting transformants on LB agar plates containing ceftazidime (CAZ, 6 mg/L). After 24 h, colonies were screened for bla_KPC using the KPC_FW and KPC_RV primer pair, as previously described (13 (link)).
The CAZ and MEM MICs of the KPC-positive E. coli DH5α transformants were tested using microdilution (MicroScan system; Beckman Coulter Inc.). The CZA MICs were determined using Etest strips (Liofilchem).
The plasmid content of transformants showing different CZA and MEM resistance was sequenced using ONT. To confirm the position of bla_KPC-31 and bla_KPC-3 at the Tn4401 copies flanking the traS and traN genes, respectively, PCR was performed with the KPC_INT/TraN_RV and KPC_INT/TraS_FW primer pairs, followed by nested PCR performed with the KPC_INT and KPC_RV primer pair. The bla_KPC amplicons were sequenced using the Sanger method with both the KPC_INT and KPC_RV primers (see Table S1 in the supplemental material).

The primers designed to introduce the H377A mutation were 5′‐CCTTGTGGTTTTTGCCAGCCCGGTACACCATC‐3′ and 5′CTGGATGGTGTACCGGGCTGGCAAAAACCAC‐3′. Those designed to introduce the H399A mutation were 5′‐GTCAGCAGTGGAGCGGCGAGCTTGTTCAGAAC‐3′ and 5′‐GGTTCTGAACAAGCTCGCCGCTCCACTGCTG‐3′. PCR was performed using Phusion high‐fidelity DNA polymerase (New England Biolabs) according to the manufacturer's instructions. In each reaction, 10 ng template (pET15b‐TEV:nrp2‐b1 or pET15b‐TEV:nrp2‐b1b2) was added. The PCR product was treated with DpnI at 37 °C for 1 h to cleave the mother template, followed by transformation of Escherichia coli DH5α cells (Invitrogen, Thermo Fisher Scientific, Carlsbad, CA, USA). The presence of the doubly mutated gene sequence (His377Ala/His399Ala) was confirmed by DNA sequencing (Source BioScience, Nottingham, UK).

DNA for the construction of libraries was isolated from the filters, sediment samples and from pools of cultured sediment bacteria using the PowerSoil DNA isolation kit (MoBio Laboratories, Carlsbad, CA) according to the manufacturer's recommendations. DNA was either partially digested with PstI (NEB, USA) and cloned into the pCF430 vector (Newman and Fuqua, 1999 (link)) or digested with HindIII (NEB, USA) and cloned into the pZE21-MCS vector (Lutz and Bujard, 1997 (link); Table 1). Ligation products were dialyzed using 0.2-μm filter membranes (Millipore, Ireland) and electroporated into Escherichia coli DH5α cells (Invitrogen, Carlsbad, CA) using a Micropulser (Biorad, Hercules, CA). After a 1 h incubation in SOC media, cells were plated on LB plates supplemented with 5 mg L⁻¹ tetracycline (Industry area 1) or 50 mg L⁻¹ kanamycin (Industry area 2), and incubated at 37°C overnight. Library storage and size estimation were performed according to previously published protocols (Wichmann et al., 2014 (link)). Briefly, the average insert size for each library was determined by restriction digest analysis of 10 randomly picked clones using PstI (pCF430) or HindIII (pZE21-MCS). After insert size analysis, all clones were pooled together by scraping them from plates into LB supplemented with 20% glycerol and tetracycline or kanamycin followed by storage at −80°C.

The ~500 bp amplicon corresponding to N22 region was excised and extracted with the QIAquick Gel Extraction kit (Qiagen, Germany). The purified PCR product was cloned using commercial vector kit (Promega Corporation, WI, USA). Reaction mixture contained 50 ng pGEM®-T Easy vector, purified amplicon, 1X ligation buffer and 3 Weiss units of T4 DNA Ligase and resulting plasmids were transformed into Escherichia coli DH5α cells (Invitrogen, USA) by heat shock method. The transformed cells were grown on LB-agar plates containing 100 μg/mL ampicillin (Sigma-Aldrich, USA). Insertion was confirmed by colony PCR and sequencing using T7 and target specific primers, as described in our previous studies
[29 (link),31 (link)]. Database searches were performed using NCBI BLAST (http://www.ncbi.nlm.nih.gov/BLAST). Phylogenetic analysis was performed using neighbour joining algorithm of PHYLIP program package (http://evolution.gs.washington.edu/phylip.html). Data set was bootstrap re-sampled 1000 times to ascertain support for major branches of the tree.