Ab283656

Manufactured by Abcam

Sourced in United Kingdom

Ab283656 is a lab equipment product. It serves a core function of performing a specific laboratory task.

Automatically generated - may contain errors

Lab products found in correlation

Ab93876, by Abcam (1 mentions) Ab236639, by Abcam (1 mentions) Ab21286, by Abcam (1 mentions) Ecl kit, by Merck Group (1 mentions) Ripa buffer, by Beyotime (1 mentions) Ab7090, by Abcam (1 mentions) Ab62582, by Abcam (1 mentions) Ab260043, by Abcam (1 mentions) Ab229126, by Abcam (1 mentions) Ab23981, by Abcam (1 mentions) Ab14106, by Abcam (1 mentions) Ab124964, by Abcam (1 mentions)

4 protocols using ab283656

Evaluating Inflammatory and Osteogenic Markers in BMSCs

Check if the same lab product or an alternative is used in the 5 most similar protocols

In order to assess the gene expression of inflammatory cytokines and osteogenic-related factors, qRT-PCR was applied as we described before [32 (link)]. The primers are listed in Table 1.Table 1

Primers used for qRT-PCR.

Table 1

Gene	Forward Primer	Reverse Primer
GADPH	AGGTCGGTGTGTGAACGGATTTG	TGTAGACCATGTAGTTGAGGTCA
IL-1β	TGGAGAGTGTGGATCCCAAG	GGTGCTGATGTACCAGTTGG
TNF-α	CTGAACTTCGGGGTGATCGG	GGCTTGTCACTCGAATTTTGAGA
ALP	CCAACTCTTTTGTGCCAGAGA	GGCTACATTGGTGTTGAGCTTTT
OPN	CAGGGAGGCAGTGACTCTTC	AGTGTGGAAAGTGTGGCGTT
Runx 2	TTCAACGATCTGAGATTTGTGGG	GGATGAGGAATGCGCCCTA

To explore the osteogenic differentiation of BMSCs under inflammatory conditions, the protein expression of Col I, Runx2, OCN and OPN was determined by western blot analysis as we previously described [32 (link)]. Anti-Col I (ab21286, Abcam, UK), anti-Runx2 (ab236639, Abcam, UK), anti-OPN (ab283656, Abcam, UK) and anti-OCN (ab93876, Abcam, UK) primary antibodies were used in this study.

He Z., Liu S., Li Z., Xu J., Liu Y, & Luo E. (2022). Coaxial TP/APR electrospun nanofibers for programmed controlling inflammation and promoting bone regeneration in periodontitis-related alveolar bone defect models. Materials Today Bio, 16, 100438.

+ Open protocol

+ Expand

Western Blot Analysis of Osteogenic Markers

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total cellular protein was isolated from the cells using the radio-immunoprecipitation assay (RIPA) buffer (Beyotime) containing protease inhibitors at 4 ºC for 30 min. Protein concentrations were measured with BCA protein, separated by SDS-PAGE (30 µg/well), and transferred to polyvinylidene fluoride membranes and blocked. The membranes were incubated with primary antibodies including ALP (ab229126, Abcam), OPN (ab283656, Abcam), RUNX2 (ab23981, Abcam), Colla1 (ab260043, Abcam), and KDM1A (ab62582, Abcam). Afterward, these membranes were washed and followed by incubation with a secondary antibody (ab7090, Abcam). Eventually, an ECL kit (Millipore) was utilized to visualize the protein bands.

Liu A., Chen Y., Zhong D., Wang C., Yu M., Liu C., Yang Z., Chen W, & Yin K. (2022). CircRNA AFF4 induced by KDM1A promotes osteogenic differentiation through FNDC5/Irisin pathway. Molecular Medicine, 28, 134.

+ Open protocol

+ Expand

Western Blotting Protein Detection Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols

The equal mass proteins were separated on SDS polyacrylamide gels and transferred to polyvinylidene fluoride (PVDF) membranes. The membranes were then incubated in primary antibody at 4 °C overnight. The western blot bands were imaged using a Biochem System (BIO-RAD). Primary antibodies in our study were antibodies against α-SMA (1:1000, Abcam, ab124964), Sm22α (1:1000, Abcam, ab14106), Opn (1:1000, Abcam, ab283656), Vimentin (1:1000, Abcam, ab92547), P-AKT (1:2000, Cst, 4060), AKT (1:1000, Cst, 4685), SRPK1 (1:1000, ProteinTech, 14073-1-AP), HSP90 (1:1000, Santa Cruz, sc-13119), FLAG (1:50, Cst, 14793), KLF9 (1:200, Santa Cruz, sc-376422), Lamin B1 (1:20000, ProteinTech, 66095-1-Ig) and GAPDH (1:100000, ProteinTech, 60004-1-Ig).

Li Z., Zhao Y., Pan Z., Cai B., Zhang C, & Jiao J. (2024). LncRNA-LncDACH1 mediated phenotypic switching of smooth muscle cells during neointimal hyperplasia in male arteriovenous fistulas. Nature Communications, 15, 3743.

+ Open protocol

+ Expand

Quantitative Protein Analysis via SDS-PAGE

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

The samples were collected using a cell lysis buffer and processed according to a previously reported method [23 (link)]. In this study, a total of 25 μg of proteins underwent separation using the SDS-PAGE technique. Subsequently, the separated proteins were transferred onto an NC membrane. The NC membrane was blocked with 5% non-fat milk before the addition of the primary antibody and IRDye 800CW-conjugated secondary antibody. Fluorescence intensity was measured using the LI-COR Imaging System (LI-COR Biosciences). The primary antibodies used were SPP1 (1:1000, ab283656, Abcam), β-actin (1:1000; 27309-1-AP, Proteintech).

Ouyang L., Sun M.M., Zhou P.S., Ren Y.W., Liu X.Y., Wei W.Y., Song Z.S., Lu K, & Yang L.X. (2024). LncRNA FOXD1-AS1 regulates pancreatic cancer stem cell properties and 5-FU resistance by regulating the miR-570-3p/SPP1 axis as a ceRNA. Cancer Cell International, 24, 4.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!