Prl renilla luciferase control reporter

Reporter plasmids were constructed by ligation of synthetic oligonucleotide duplexes (IDT) containing putative mir-26a target regions in the ULK1 3’UTR: 5’ CTAGTCCTGAATCAGTAGATACTTGAA3’ and 5’AGGACTTAGTCATCTATGAACTTTCGA 3’ or mutant ULK1 3’ UTR target region 5’CTAGTCCTGAATCAGTAGACGTCCAGACGAA3’ and 5’AGCTTTCGTCTGGACGTCTACTGATTCAGGA3’, obtained from TargetScan (31 (link)), microRNA.org (32 (link)) and Starbase (33 (link)), forming a DNA duplex with overhanging SpeI and HindIII half-sites in the 5’ and 3’ ends respectively, which was cloned into the appropriately digested pMIR-REPORT plasmid (Ambion). This construct was co-transfected with mir-26a mirVana miRNA mimic (Applied Biosystems) and the pRL Renilla Luciferase Control Reporter (Promega) into HCT116 cells. Luciferase activity was analyzed using the Dual-Luciferase Reporter Assay System (Promega) 24 h after transfection, in a GloMax 96 Microplate Luminometer (Promega). Luciferase activity was normalized to Renilla activity for each transfected well; each experiment was performed by triplicate.

To study EBNA1-dependent transactivation, the luciferase vector J988F containing the EBV C promoter and oriPI (family of repeats) was constructed. The EBV C promoter and oriPI (nucleotides 7447 to 11412) regions were subcloned from the previously described plasmid pgCp(-3889)CAT (33 (link), 34 (link)) as a HindIII fragment into the pGL3Basic luciferase vector (Promega). Correct sequences were ascertained by Sanger sequencing using the ABI PRISM Big Dye terminator cycle sequencing kit (Applied Biosystems). EBV-positive C666-1 and NPC43 cells were then transiently transfected with the J988F reporter plasmid. Cells were seeded in 12-well plates and cotransfected with the J988F plasmid (2 µg per well) and a pRL Renilla luciferase control reporter (500 ng per well) (Promega) using Lipofectamine 2000 (Invitrogen). After 24 h, the cells were treated with ZRL₅P₄, L₂P₄, EDTA, or TPEN (10 µM) for another 8 h. Cells were lysed with Passive Lysis Buffer (Promega), and the lysate was then transferred onto a white, opaque, 96-well plate. The luciferase activities were measured using the Dual Luciferase Reporter Assay System (Promega) with the GloMax 96 Microplate Luminometer (Promega). The pRL Renilla luciferase reporter was used as an internal control to normalize the transfection efficiency among the samples.

HEK293T cells were plated in 12-well plates at the density of 50,000 cells ml⁻¹. When confluent, cells were transfected using Fugene-HD (Promega) with a combination of (1) pGL4 Firefly luciferase reporter (Promega, E6651), (2) pRL Renilla luciferase control reporter (Promega, E2241), and (3) FLAG-hSP7 or FLAG-hSP7^R316C or GFP control (VectorBuilder, EF1A as a promoter, vector IDs are VB190819-1114pvu, VB190819-1115xzu, and VB180924-1105fst) plasmids. Ostn_En2 sequence was synthesized with gBlocks Gene Fragments (IDT) (See sequence information in Supplementary Data 10). SacI and BglII restriction enzymes (NEB R0156S, R0144S) were used to cut both the pGL4 plasmid and the Ostn_En2 fragment. In all, 48 h later, cells were disassociated by adding Passive Lysis Buffer (Promega, E1910) and were gently rocking on an orbital shaker for 15 min. In all, 20 µl cell lysate was transferred to 96-well black polystyrene microplates (Corning). In all, 50 µl of Luciferase Assay Reagent II was dispensed to each well with the reagent injector. The sample plate was placed in the luminometer to measure the Firefly luciferase signal. In all, 50 µl of Stop & Glo Reagent was then dispensed to each well. The plate was placed back to the luminometer to measure Renilla luciferase activity. Luciferase experiments were performed in biologic triplicate, and all experiments were repeated at least twice.