Bigdye terminator v3.1 cycle sequence kit

Macrolide resistance mediating mutations were detected from cultured strains and clinical specimens by sequencing of domain V of the 23S rRNA gene as previously described [9 (link)] using primers 23S-1992F (5'-CCATCTCTTGACTGTCTCGGCTAT) and 23S-2138R (5'-CCTACCTATTCTCTACATGGTGGTGTT) in a conventional PCR. The 147 bp amplicon was sequenced using BigDye Terminator v3.1 Cycle Sequence Kit (Applied Biosystems, Foster City, CA) on an ABI 3030x1 (Applied Biosystems).
The SNPs for fluoroquinolone resistance were detected from cultured strains and clinical specimens by sequencing the QRDR of the gyrA and parC genes as previously described [23 (link)]. Nucleotides 172–402 of gyrA were amplified using primers gyrA-F (5'-CGTCGTGTTCTTTATGGTGC) and gyrA-R (5'-ATAACGTTGTGCAGCAGGTC). Nucleotides 164–483 of parC were amplified using primers parC-F (5'-TGGGCTTAAAACCCACCACT) and parC-R (5'- CGGGTTTCTGTGTAACGCAT) [23 (link)]. The target amplicons were sequenced using the amplification primers.

The regions of interest, which were the C-terminal, central, and N-terminal of RYR1, were removed from the RYR1/pBI using restriction enzymes. Each fragment was inserted into the pBluescript II KS (+) vector (Stratagene Cloning Systems, La Jolla, CA, USA) and used as a template for mutagenesis. Mutagenesis was performed using the QuikChange II XL site-directed mutagenesis kit (Agilent Technologies, Santa Clara, CA, USA). We designed the following three mutation primers, which have been detected in MH patients: 5′-GAT GCT GGC CAA CAT GGT GGA GGC TGG CGT-3′ for p.Thr84Met, 5′-GTT AAC GGC GAG AGA GTG GAG AAC-3′ for p.Ser2345Arg, and 5′-CGT GGG CGT CCG GAC TGG CGG AGG-3′ for p.Ala4894Thr. After mutagenesis, we sequenced pBluescript II KS (+) using an ABI PRISM 3100 genetic analyzer (Applied Biosystems, Foster City, CA, USA) using a BigDye Terminator v3.1 cycle sequence kit (Applied Biosystems). To construct the vectors for expressing the mutated RYR1 gene, the mutated fragments were removed from the pBluescript II KS (+) plasmid using the restriction enzymes NheI and KpnI for p.Thr84Met, SpeI and BsiWI for p.Ser2345Arg, and ClaI and HindIII for p.Ala4894Thr and ligated into RYR1/pBI.