Anchored oligo dt

Total RNA from each sample was extracted by using TRI Reagent according to the manufacturer's instructions. The concentration and purity of RNA was determined by use of the NanoDrop 2000c (Thermo Scientific). Reverse transcriptase (RT) was performed by using the Enhanced Avian RT First Strand Synthesis Kit (Sigma) with Anchored oligo(dT) (Thermo Scientific) and PCR nucleotide mix (Fisher) to generate cDNA by using 2 μg of RNA. TNF-α validated primers were purchased from Primerdesign, reconstituted, and used as specified in the supplemental data sheet. The TNFR2, SOCS3, and housekeeping gene RPLPO primers were designed and checked for specificity by use of BLAST search from the National Center for Biotechnology Information (NCBI). Forward and reverse primers (Sigma) were first reconstituted in autoclaved Milli-Q water to 100 μM according to the supplied data sheet before being used to amplify TNFR2, SOCS3, and RPLPO cDNA. The primer sequences used to amplify TNFR2 (148 bp) were Forward: GAGTGGTGAACTGTGTCATGA and Reverse: GAGCTCGGCGCTGTGATC; SOCS3 (119 bp) Forward: TCGATTCGGGACCAGCCCCC and Reverse: TGCTGTGGGTGACCATGGCG; and RPLPO (142 bp) Forward: GCAATGTTGCCAGTGTCTG and Reverse: GCCTTGACCTTTTCAGCAA.

For RT-qPCR, 50 ng or 500 ng of total RNA was used to generate the first strand using 1 μL of Superscript II (Invitrogen, #18064014) and 1 μL of anchored oligo-dT (ThermoFisher Scientific, #AB1247) in 20 μL total reaction mix following the protocol. cDNA was diluted five times using nuclease-free water, and 2 μL was used for each qPCR reaction. Quantitative real-time PCR was performed in three technical replicates on the ABI-7900HT Real-Time PCR System (Applied Biosystems) using the PowerUp SYBR Green Master Mix (Applied Biosystems, #A25742) using standard procedures. The qPCR primers for the target genes (ADIPOQ, AXIN2, BCAT, CEBPB, FABP4, HPRT, LEP, LPL, PNPLA2, and PPARG, see Additional file 2: Table S5) were designed with Primer3 software (RRID:SCR_003139) [34 (link)].