Total protein was isolated from cells by RIPA (Sigma-Aldrich) on ice. The supernatants were centrifuged at 12 000g for 10 minutes at 4°C before the collection of the supernatant proteins. The concentration of protein in each sample was measured by the BCA kit (Sigma-Aldrich). Each protein sample (15 µg) was separated by the SDS-PAGE and transferred onto a PVDF membrane. Then the PVDF membrane was blocked by 5% fat-free milk at 37°C for 1 hours, incubated with primary antibodies against IL-1β (ab200478; RRID:AB_2888939; 1:1,000; Abcam), TNF-α (ab205587; RRID:AB_2889389; 1:1,000; Abcam), MAPK6 (ab53277; RRID:AB_2140288; 1:1,000; Abcam) and GAPDH (ab181602; RRID:AB_2630358; 1:1,000; Abcam) at 4°C overnight; and HRP-conjugated goat anti-rabbit secondary antibody (ab7097; RRID:AB_955411; 1:3,000; Abcam) at 37°C for 1 hours, successively. At last, the protein bands were visualized by ECL Kit (Pierce). Immunodetection was analyzed by Image Lab version 3.0 (Bio-Rad Laboratories, Inc.). IL-1β, TNF-α, and MAPK6 were referred to as GAPDH.
Image lab version 3
Manufactured by Bio-Rad
Sourced in United States
Image Lab version 3.0 is a software application designed for the analysis and quantification of gel and blot images. The software provides tools for image acquisition, processing, and analysis.
Automatically generated - may contain errors
Lab products found in correlation
Chemidoc xrs system, by Bio-Rad (7 mentions)
Pvdf membrane, by Merck Group (6 mentions)
Pierce ecl western blotting kit, by Thermo Fisher Scientific (4 mentions)
Protein assay, by Bio-Rad (4 mentions)
Trans blot turbo transfer system, by Bio-Rad (4 mentions)
Bca assay, by Beyotime (4 mentions)
Ripa lysis buffer, by Beyotime (4 mentions)
Enhanced chemi luminescence (ecl), by Cytiva (4 mentions)
Mini protean tgx precast 4 15 gradient gels, by Bio-Rad (3 mentions)
Ab32351, by Abcam (3 mentions)
Ab32042, by Abcam (3 mentions)
Ecl system, by Clinx (3 mentions)
Beyogel plus page, by Beyotime (3 mentions)
Goat anti rabbit igg hrp se134, by Solarbio (3 mentions)
Goat anti mouse igg hrp se131, by Solarbio (3 mentions)
Immobilon p pvdf membrane, by Merck Group (3 mentions)
Chemidoctr xrs, by Bio-Rad (3 mentions)
Ripa buffer, by Beyotime (2 mentions)
P0448, by Agilent Technologies (2 mentions)
Ab32503, by Abcam (2 mentions)
33 protocols using image lab version 3
1
Protein Isolation and Quantification
2
Amplification and Purification of E. hirae 16S rRNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
16S rRNA region of E. hirae F2 was amplified by using 1X (final concentration) ReadyMix™ Taq PCR Reaction Mix (Sigma-Aldrich, Bangalore, India) and template DNA (50 ng/ µL). The reaction was carried out in Thermal cycler (Applied Biosystems Veriti; Applied Biosystems, Foster City, CA, USA). Pair of universal primers 27f and 1492r was used to amplify 16S rRNA region. 27f 5′AGAGTTTGATCMT GGCTCAG3′ used as a forward and 1492r 5′CGGTTACCTTGTTACGACTT3′ was used as a reverse primer (Weisburgv et al., 1991 (link)). PCR reaction mixture contained 1 x reaction mixture (10 µL), forward primer (1 µL), reverse primer (1 µL), genomic DNA template (2 µL), nuclease free water (6 µL). PCR program was adjusted as: Initialization at 95 °C for 5 min, 30 cycles of denaturation at 95 °C for 1 min, annealing at 55 °C for 1 min, extension at 72 °C for 1 min; and a final elongation step at 72 °C for 3 min followed by hold at −4 °C for ∞ time. Amplified PCR products were detected on agarose gel (1%) by electrophoresis staining with ethidium bromide and visualizing under UV light. The gels were analyzed by using the software Image lab version 3.0 (Bio Rad, Hercules, CA, USA). Purification of amplified PCR product was done using GenElute™ PCR Clean-up kit (Sigma®, India).
3
Protein Analysis of Bone Marrow-Derived Mesenchymal Stem Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
BMSCs were washed with ice-cold phosphate buffered saline and treated with RIPA buffer (Beyotime Institute of Biotechnology) for 30 min at 4°C. Supernatants were centrifuged at 12,000 × g at 4°C for 10 min and collected to measure the supernatant proteins using the BCA method (Beyotime Institute of Biotechnology). Total protein (50–100 µg) was subjected to electrophoresis on a 12.5% SDS-PAGE gel and then transferred onto polyvinylidene fluoride membranes (Bio-Rad Laboratories, Inc.). The membrane was blocked with tris-buffered saline with 0.1% Tween-20 containing 5% fat-free dried milk at 37°C for 1 h and incubated with anti-PPARγ (cat no. sc-1981; 1:500; Santa Cruz Biotechnology, Inc., Dallas, TX, USA), Wnt-3 (cat no. sc-74537; 1:500; Santa Cruz Biotechnology, Inc.) anti-β-Catenin (cat no. sc-31001; 1:500; Santa Cruz Biotechnology, Inc.) and anti-GAPDH (cat no. sc-48166; 1:500; Santa Cruz Biotechnology, Inc.) at 4°C overnight, followed by incubation with a goat anti-rabbit IgG secondary antibody (BA1070; 1:5,000; Wuhan Boster Biological Technology, Ltd., Wuhan, China). Immunodetection was conducted using enhanced chemiluminescence (Applygen Technologies, Inc., Beijing, China) and analyzed using Image Lab version 3.0 (Bio-Rad Laboratories, Inc.).
4
Western Blot Analysis of Protein Samples
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Protein samples were prepared for Western blot analysis as described previously [14 (link)]. Protein concentrations were quantified using the Bio-Rad protein assay (Bio-Rad, Hercules, CA, USA) with bovine serum albumin (BSA) as a standard. Thirty micrograms of protein were separated on Mini-PROTEAN® TGX™ precast 4–15% gradient gels (Bio-Rad) and transferred to nitrocellulose membranes using the Trans-Blot Turbo transfer system, (Bio-Rad). Primary antibody details and dilutions are listed in Supplementary Table S2 and appropriate horseradish peroxidase (HRP)-conjugated secondary antibodies (1:2000; P0448, DAKO) were used for detection. Proteins were detected using the Pierce ECL Western blotting kit (Thermo Fisher Scientific). Images were captured using the ChemiDoc XRS system and Image Lab version 3.0 (Bio-Rad).
5
Western Blot Analysis of NOS2 Protein
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
After extraction of proteins using RIPA buffer (Beyotime Institute of Biotechnology), BCA protein concentration detection kit (cat. no. P0009; Beyotime Institute of Biotechnology) was used to measure the concentrations of target proteins. The protein samples were mixed with SDS-PAGE loading buffer before boiling for 5 min. Then, 20 µg protein samples were loaded for 10% SDS-PAGE. On ice bath, the samples were transferred onto PVDF membrane at 100 V for 2 h, and then blocked with 5% skimmed milk at room temperature for 1 h. Then, primary antibodies of NOS2 (cat. no. ab3523; 1:800; rabbit anti-rat, polyclonal; Abcam) and internal reference β-actin (cat. no. ab129348; 1:5,000; rabbit anti-rat, Abcam) were used to incubate the membrane at 4˚C overnight. Afterwards, secondary antibody (cat. no. ab6721; 1:3,000; goat anti-rabbit; Abcam) was used to incubate the membrane at room temperature for 1 h. The membrane was then soaked in electrochemiluminescence liquid (cat. no. ab65623; Abcam), and imaged in gel imaging system. Then, Image Lab (version 3.0; Bio-Rad Laboratories, Inc.) was used to analyze the protein bands, and the relative expression of target protein was expressed as the ratio of target protein greyscale against β-actin greyscale.
6
Quantitative SDS-PAGE Protein Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
SDS-PAGE was performed using an XCell SureLock system (Thermo Fisher) with 10%, 12% or 14% polyacrylamide gels. Samples were mixed with 6× SDS loading buffer [234 mM Tris-HCl pH 6.8, 24% (v/v) glycerol, 120 μM bromophenol blue, 234 mM SDS, supplemented with 60 mM dithiothreitol (DTT) for reduced samples]. Samples were heated at 95 °C for 5 min in a Bio-Rad C1000 thermal cycler. Gels were run in 24 mM Tris base, 192 mM glycine, 3.5 mM SDS at 200 V and stained with Coomassie Brilliant Blue G-250. After destaining in MilliQ water, gels were imaged using a ChemiDoc XRS + imager with ImageLab version 5.2.1, and analyzed with ImageLab version 3.0 (both Bio-Rad). For quantification of protein purity in ImageLab, high sensitivity band detection was performed. Additional bands were added manually where the automatic detection had failed to detect faint bands. 1 mm background subtraction was applied. The percentage purity is quantified as (band intensity of protein of interest)/(sum of the band intensities from all bands in lane)×100. The lane profile was plotted by intensity.
7
Western Blot Analysis of Osteoblast Proteins
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The total protein of primary osteoblasts was extracted using RIPA lysis buffer (Beyotime, China) and quantified by BCA assay (Beyotime, China). Equal amounts of proteins (100 μg) were separated via BeyoGel™ Plus PAGE (Beyotime, China) and then transferred to a PVDF membrane (Millipore, USA). After transferring, the membranes were blocked with 5% fat-free milk for 1 h. The membranes were incubated with primary antibodies (Bax, ab32503; Caspase-3, ab32351; and cleaved-Caspase-3, ab32042) purchased from Abcam (USA) and GAPDH, 10494-I-AP purchased from Proteintech (China) at 4°C overnight. The membranes were incubated with second antibodies (goat anti rabbit IgG HRP SE134, goat anti mouse IgG HRP SE131, Solarbio, China) at 37°C for 1 h. The ECL system (CLINX, China) was used for exposing protein bands. The intensity of the bands was analyzed using Image Lab (version 3.0, Bio-Rad, USA).
8
Immunoblot Analysis of Photosynthetic Proteins
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Immunoblot analyses were performed as previously described (75 (link)). Loading of samples was based on either an equal Chl or protein basis, as indicated. Denatured proteins were resolved in precast 10 to 20% gradient SDS/PAGE (Invitrogen) and transferred to polyvinylidene difluoride membranes (Immobilon-FL; 0.45 μm; Millipore) in a tank electrotransfer system. Polyclonal antibodies against D2, D1, PsbO, PsbE, CP43, and PsaD were obtained from Agrisera, Sweden, and ALB3 from D.S. The antibody against HCF136 was a kind gift from Karin Meierhoff, Heinrich-Heine-Universität Düsseldorf, Germany. Polyclonal antibodies against Chlamydomonas and Arabidopsis RBD1 proteins were generated and described in published procedures (34 (link)). Immunoblot signals were visualized by Supersignal West Pico Chemiluminescent substrate detection system (Thermo Fisher Scientific) in a ChemiDoc MP imager and quantitated with Image Lab, version 3.0 (Bio-Rad).
9
Western Blot Analysis of RBP4 and GAPDH
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Protein samples were prepared for Western blot analysis as described previously.59 (link) Protein concentrations were quantified using the Bio-Rad protein assay (Bio-Rad, Hercules, CA) with bovine serum albumin as standard. Equal amounts of protein were separated on Mini-PROTEAN TGX precast 4%–5% gradient gels (Bio-Rad) and transferred to nitrocellulose membranes using the Trans-Blot turbo transfer system (Bio-Rad). Primary antibodies (anti-RBP4, 1:2,000; #ab109193 [Abcam, Cambridge, United Kingdom] and anti-GAPDH, 1:40,000 #CB1001 [Calbiochem; Merck-Millipore, Amsterdam-Zuidoost, the Netherlands]) and horseradish peroxidase–conjugated goat anti-rabbit secondary antibodies (1:2000; Agilent DAKO, Amstelveen, the Netherlands) were used for detection. Proteins were detected using the Pierce ECL Western blotting kit (Thermo Fisher Scientific). Images were captured using the chemidoc XRS system and Image Lab version 3.0 (Bio-Rad). The intensity of bands was quantified using ImageJ version 1.51 (National Institutes of Health, Bethesda, MD).
10
Protein Expression Analysis by Western Blot
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To determine the levels of protein expression, cells were harvested and gently washed with cold phosphate-buffered saline (PBS). Total protein was extracted using RIPA Cell Lysis Buffer (Beyotime, Shanghai, China). For each sample, 50 μg of protein was separated by standard SDS-PAGE and then transferred to polyvinylidene difluoride membranes. The membranes were washed and blocked by 5% nonfat milk powder in TBST buffer for 1 h, and then incubated with specific primary antihuman antibodies against ATG5 (1:1000, #2630, CST, Beverly, MA, USA), LC3B (1:1000, #3868, CST, Beverly, MA, USA) and GAPDH (1:10,000, AP0063, BioWorld, St. Louis Park, MN, USA). After that, the membrane was incubated with horseradish peroxidase–conjugated secondary antibodies. The protein bands were visualized using enhanced chemiluminescence western blotting substrate (Pierce, MA, USA), and captured by ChemiDoc™ XRS + system (Bio-Rad Laboratories, CA, USA) and the densitometry of the protein bands were determined by ImageLab version 3.0 (Bio-Rad Laboratories, CA, USA).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!