Pmirglo reporter vector

Manufactured by Thermo Fisher Scientific

Sourced in United States

The PmirGLO reporter vector is a plasmid-based tool used for gene expression studies. It contains a multiple cloning site for insertion of a gene of interest and reporter genes for detection and quantification of gene expression levels. The core function of this product is to facilitate the evaluation of gene expression in a variety of cell types and experimental conditions.

Automatically generated - may contain errors

Lab products found in correlation

Dual luciferase reporter assay system, by Promega (3 mentions) Pmirglo reporter vector, by GenePharma (1 mentions) Lipofectamine 2000, by Thermo Fisher Scientific (1 mentions) Quikchange lightning site directed mutagenesis kit, by Agilent Technologies (1 mentions) Ecori, by Takara Bio (1 mentions) Pcdna3.1 pcdna3.1 expression vector, by Thermo Fisher Scientific (1 mentions) Bamhi, by Takara Bio (1 mentions)

Close spelling variants of this product

PmirGLO vector PmirGLO

4 protocols using pmirglo reporter vector

Identifying miR-137 target genes

Check if the same lab product or an alternative is used in the 5 most similar protocols

The potential targets of ZFPM2-AS1 or miR-137 were predicted using miRBase 21.0 (http://www.mirbase.org/) or TargetScan 7.2 (http://www.targetscan.org/vert_72/). The sequences of the NC, wild-type (WT) ZFPM2-AS1 (ZFPM2-AS1-WT) and mutant (MUT) ZFPM2-AS1 (ZFPM2-AS1-MUT) were inserted into the pmirGLO reporter vector (Shanghai GenePharma Co., Ltd.). Subsequently, pmirGLO-NC, pmirGLO-ZFPM2-AS1-WT and pmirGLO-ZFPM2-AS1-MUT were co-transfected into SW480 and HCT116 cells along with the miR-137 mimics or miR-NC using LTX (Invitrogen; Thermo Fisher Scientific, Inc.).
Similarly, the sequences of NC, TRIM24-WT and TRIM24-MUT were inserted into the pmirGLO reporter vector. pmirGLO-NC, pmirGLO-TRIM24-WT and pmirGLO-TRIM24-MUT were then co-transfected into SW480 and HCT116 cells along with the miR-NC or miR-137 mimics with Lipofectamine 2000. Following 48 h of transfection, the relative luciferase activity was analyzed using the Dual Luciferase Reporter Assay System (Promega Corporation). The Renilla luciferase was selected as an internal control.

Xiao M., Liang Z, & Yin Z. (2020). Long non-coding RNA ZFPM2-AS1 promotes colorectal cancer progression by sponging miR-137 to regulate TRIM24. Molecular Medicine Reports, 23(2), 98.

+ Open protocol

+ Expand

Characterizing SIRT1 3'UTR Regulatory Interactions

Check if the same lab product or an alternative is used in the 5 most similar protocols

The 3′-UTR sequence of the SIRT1 gene was generated from a mouse cDNA library and cloned into the pmiR-Glo reporter vector (Invitrogen, USA) at the PmeI and XhoI sites. The primer sequences were as follows: mSirt1-PmeI Forward 5'-AGCTTTGTTTAAACGAAGCT GTCCGGATTCAGGA-3', mSirt1-XhoI Reverse 5'-CCGCTCGAGTCCAGTCATTAAACGGTCTACA-3'. This wild-type plasmid was designated SIRT1-Wt. The potential target sites were predicted by TargetScan (http://www.targetscan.org/), miRWalk (http://zmf.umm.uni-heidelberg.de/apps/zmf/mirwalk2/) and MICRORNA (http: //www. Microrna.org/microrna/home.do). SOE PCR was used to generate the mutant binding site plasmid [49 (link)]. This plasmid was designated SIRT1-Mutation. The mutated primer sequences were as follows: Forward 5'-TTGGTGCTCAGTTACTGAAAGCGTACTTA-3', Reverse 5' TAAGTACG CTTTCAGTAACTGAGCACCAA-3'. For luciferase reporter assays, BHK cells seeded in a 48-well plate (1×10⁵ cells/well) were co-transfected with 0.75 pmol (30 nM) of miRNA mimics or negative control (GenePharma, Shanghai, China) and SIRT1-Wt or SIRT1- Mutation using lipofectamine 2000 (Invitrogen, USA). Cell lysates were obtained 24 h after transfection and luciferase activity was analyzed by using the Dual Luciferase Reporter Assay System (Promega, USA).

Peng J., Wu Y., Deng Z., Zhou Y., Song T., Yang Y., Zhang X., Xu T., Xia M., Cai A., Liu Z, & Peng J. (2017). MiR-377 promotes white adipose tissue inflammation and decreases insulin sensitivity in obesity via suppression of sirtuin-1 (SIRT1). Oncotarget, 8(41), 70550-70563.

+ Open protocol

+ Expand

Characterizing miR-4262 Regulation of GALNT4

Check if the same lab product or an alternative is used in the 5 most similar protocols

The 3′UTR of GALNT4 in the pMir-GLO reporter vector was purchased from Ambion; Thermo Fisher Scientific, Inc. (catalog no. AM5795). The miR-4262 binding site was mutated using QuikChange Lightning Site-Directed Mutagenesis kit (Agilent Technologies Inc., Santa Clara, CA, USA), according to the manufacturer's protocol. Wildtype (GALNT4 3′UTR wt) and mutant constructs (GALNT4 3′UTR mut) were transfected into SW480 and SW620 cells concurrently with miR-4262 mimic or mimics ctrl. Cells were analyzed for relative luciferase activity using the Dual-Luciferase Reporter Assay System (Promega Corporation, Madison, WI, USA), 48 h following transfection. The experiment was conducted in triplicate.

Qu J.J., Qu X.Y, & Zhou D.Z. (2017). miR-4262 inhibits colon cancer cell proliferation via targeting of GALNT4. Molecular Medicine Reports, 16(4), 3731-3736.

+ Open protocol

+ Expand

Plasmid Construction for CRNDE and ATG4B

Check if the same lab product or an alternative is used in the 5 most similar protocols

The DNA fragments encoding the wild type and the mutant human CRNDE were chemically synthesized by Sangon Biotech (Shanghai, China), and separately inserted into pcDNA3.1(+) (pcDNA3.1) expression vector (Invitrogen) after digestion with EcoRI (Takara) and BamHI (Takara). The recombinant plasmids were named as pcDNA-CRNDE and pcDNA-CRNDE-mut, respectively. pcDNA-CRNDE-mut contained mutations of the predicted miR-543 binding site in CRNDE sequence (1008 CTTTATTGGATTGAATGAATGTTT 1031, the underlined nucleotides were mutated). The DNA fragments encoding the wild type and the mutant 3′-UTR of human ATG4B mRNA were separately synthesized by Sangon Biotech, digested with SacI (Takara) and SalI (Takara), and then cloned into pmir-GLO reporter vector (Thermo Scientific, Waltham, MA, United States). The reconstructed plasmids were named as pmir-ATG4B and pmir-ATG4B-mut, respectively. pmir-ATG4B-mut contained mutations of the putative miR-543 binding site in 3′-UTR of ATG4B mRNA (1565 TGTCAGACACAGACATGAATTTCT 1588, the underlined nucleotides were mutated). The overexpression plasmid pCMV-ATG4B was bought from Lab Cell Biotechnology (Chongqing, China).

Chen L., Sun L., Dai X., Li T., Yan X., Zhang Y., Xiao H., Shen X., Huang G., Xiang W., Zhang Y., Tan D., Yang S., Nie Y., Huang X., Lian J, & He F. (2021). LncRNA CRNDE Promotes ATG4B-Mediated Autophagy and Alleviates the Sensitivity of Sorafenib in Hepatocellular Carcinoma Cells. Frontiers in Cell and Developmental Biology, 9, 687524.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!