Total RNA was extracted from tissues using TRIzol reagent according to the manufacturer‘s introduction. The RNAs were then reverse transcripted into cDNA using a HiScript cDNA synthesis kit (Vazyme). qPCR was performed using an SYBR qPCR Master Mix kit (Vazyme) following the manufacturer's protocol on the BIORAD-CFX96 Real-Time System (Bio-Rad, Hercules, CA, USA). The data were normalized by mouse Rpl19 and analyzed using the ΔΔCt method. All qPCR primers of mice were listed in Table 1 .
Hiscript cdna synthesis kit
Manufactured by Vazyme
Sourced in China
The HiScript cDNA Synthesis Kit is a laboratory equipment product designed for the reverse transcription of RNA into complementary DNA (cDNA). The kit provides the necessary reagents and components for the efficient conversion of RNA into cDNA, which is a crucial step in various molecular biology applications, such as gene expression analysis, RT-PCR, and cDNA library construction.
Automatically generated - may contain errors
Lab products found in correlation
Trizol, by Thermo Fisher Scientific (3 mentions)
Trizol reagent, by Thermo Fisher Scientific (2 mentions)
Cfx96 real time system, by Bio-Rad (1 mentions)
Sybr qpcr master mix kit, by Vazyme (1 mentions)
Sybr green dye, by Vazyme (1 mentions)
Chamq sybr master mix, by Vazyme (1 mentions)
Plant total rna extraction kit, by Sangon (1 mentions)
Golden star t6 super pcr mix, by Tsingke (1 mentions)
Universal sybr qpcr master mix, by Vazyme (1 mentions)
Chamq universal sybr qpcr master mix, by Vazyme (1 mentions)
Iq5 real time pcr system, by Bio-Rad (1 mentions)
Sybr qpcr mix, by Vazyme (1 mentions)
Tianamp bacteria dna kit, by Tiangen Biotech (1 mentions)
Nanodrop 2000 spectrophotometer, by Thermo Fisher Scientific (1 mentions)
Sybr green qpcr master mix, by Selleck Chemicals (1 mentions)
11 protocols using hiscript cdna synthesis kit
1
Transcriptomic Analysis of Mouse Tissues
2
Quantitative analysis of gene expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA extraction and RT-qPCR were performed according to the manufacturer’s instructions. The RT-qPCR was conducted using the HiScript cDNA synthesis kit (R323-01, Vazyme, China) and the SYBR RT-qPCR Master Mix (Q511-02, Vazyme, China). Primers are shown in Table S3 . Relative gene expression was calculated by the comparative CT method (ΔΔCT), and β-actin was used as a housekeeping gene.
3
Transcriptomic response to marine-montane transition
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To validate the changes in RNA expression response to the marine-montane transition, talitrids (M. aosen) were acclimated for 3 days in hypothermic (10°C) or hypoxic environments (the latter of which included a hypoxic gas mixture containing 13.5% oxygen, which is equivalent to an altitude of 3200 m). The talitrids fed at room temperature and normoxic environment were used as a control. The gills and legs were separately dissected for RNA extraction, and cDNA was generated using the HiScript cDNA Synthesis Kit (Vazyme). RT-qPCR was performed in a 20-μl system, with 50 ng of diluted cDNA and forward and reverse primers at 0.4 μM. The following conditions were used for PCR: 95°C for 5 min (initial denaturation), denaturation at 95°C for 30 s, annealing at 58°C for 30 s, and extension at 72°C for 30 s for 30 cycles to stay within the linear range of amplification. The expression levels of key genes (AMY1, ACLY, and OGDH) were calculated using the 2–ΔΔCt method. The GAPDH gene was used to normalize gene expression. All primers are listed in the table S27. All data were obtained from three independent assays with three replicates in each assay.
4
Quantifying Relative Gene Expression by RT-qPCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted in TRIzol (Invitrogen, USA), precipitated in ethanol and dissolved in RNAase/DNAase-free water. cDNA was then synthesized with 2 μg template RNA using a HiScript cDNA Synthesis Kit (Vazyme, China) containing genomic DNA wiper to exclude potential DNA contamination. The relative gene expression values were measured by real-time polymerase chain reaction (PCR) with SYBR-green dye (Vazyme, China) using the following program:Step 1, pre-denaturation at 95°C for 5 min; Step 2, 35 circles of sequential denaturation at 95°C for 10 s, then annealing and extension at 60°C for 30 s; Step 3, melt curve running from 60°C to 95°C. Three biological replicates were performed for each sample. The relative expression of mRNAs was determined by the 2−ΔΔCt method against the reference gene Actin. Target gene expression values are presented as the means ± SD. The primers used are detailed in Supplementary Table S1 .
5
Quantitative Gene Expression Analysis in Rice
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from the rice protoplasts or young leaves using the Plant Total RNA Extraction Kit (Sango Biotech Co. Ltd, Shanghai, China). Reverse transcription was performed with 1 μg using HiScript cDNA Synthesis Kit (Vazyme Biotech Co. Ltd, Nanjing, China) according to the manufacturer’s instruction. Quantitative PCR (qPCR) was performed using ChamQ SYBR Master Mix (Vazyme Biotech Co. Ltd, Nanjing, China). Each qPCR assay was replicated at least three times. The RLuc gene was used as an internal control for rice protoplasts and the rice Actin1 gene was used as the housekeeping gene for plant samples. The primers were listed in Supplementary Table 3
6
Characterization of circBART Isoforms
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted using TRIzol reagent (15596026, Invitrogen) and reverse transcribed using the HiScript cDNA Synthesis kit (R323-01, Vazyme). qRT-PCR was performed using the Universal SYBR qPCR Master Mix (Q511-02, Vazyme). The 2−ΔΔCt method was used to normalize the data.
Regular PCR experiments were carried out using the Golden Star T6 Super PCR Mix (TSE101, Tsingke) according to the instructions. Primers are listed inSupplementary Table S3 . To amplify four different circBART variants, isoform-specific primers that could be discriminated each other were designed (Fig. 1 A). The primers for circBART2.2 were designed according to its circular splice site spanning exons IV and IIIA of the BART gene, which were specific to circBART2.2 and the linear forms could not be detected. circBART2.1 and circBART2.2 could also be discriminated.
Regular PCR experiments were carried out using the Golden Star T6 Super PCR Mix (TSE101, Tsingke) according to the instructions. Primers are listed in
7
Quantitative RT-PCR for Sat-2 Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted in TRIzol (Invitrogen) and precipitated in ethanol. cDNA was then synthesized using a HiScript cDNA Synthesis Kit (Vazyme). The relative expression of Sat-2 and GAPDH were measured by real-time polymerase chain reaction (PCR) with the following primers: Sat-2, 5′-CATCGAATGGAAATGAAAGGAGTC-3′ (sense) and 5′-ACCATTGGATGATTGCAGTCAA-3′ (antisense); GAPDH, 5′-CAGCAAGAGCACAAGAGGAA-3′ (sense), 5′-CCCCTCTTCAAGGGGTCTAC-3′ (antisense).
8
OSCC Total RNA Extraction and qPCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Following the manufacturer's instructions, TRIzol (Invitrogen, USA) was applied to collect total RNAs from OSCC cells. HiScript cDNA Synthesis Kit (Vazyme, China) was applied to reverse-transcribe the common genes using a gDNA wiper. Using the ChamQ Universal SYBR qPCR Master Mix, the target genes were measured using qPCR amplification (Vazyme). GAPDH was used as the internal control. Gene amplification levels were measured using the 2−ΔΔCt methods. All the PCR primer sequences used in this study were included in Table S1 .
9
Quantification of Gene Expression using RT-qPCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from the cell lines using TRIzol reagent (Invitrogen), following the manufacturer’s instructions. Complementary DNA (cDNA) was synthesized by reverse transcription using a Hiscript cDNA synthesis kit (Vazyme). SYBR qPCR mix (Vazyme) was used to perform RT-qPCR on a Bio-Rad IQ5 real-time PCR system. The RT-qPCR assays used previously published primers (44 (link)) for specific genes: PFTK1F 5′ TGCAGAGGACCTGGCCTCCA, PFTK1R 5′ TCCCAAAGGCCCGCATGCTT, METF 5′ GCCAACCGAGAGACAAGCATCTTCA, MET1R 5′ TGCTCCCACCACTGGCAAAGC, RBM39F 5′ AGCAGTGCCAACGGCCATGA, RBM39R 5′ CTTCTTGAGCGGCTCCGTCGC, GAPDHF 5′ CCTGCCTCTACTGGCGCTGC, and GAPDHR 5′ CCTTGAGGGGGCCCTCCGAC.
10
RNA Extraction and cDNA Synthesis for Aurantiochytrium and E. coli
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For the preparation of RNA extraction, the single colony of Aurantiochytrium was inoculated into 20 mL ATCC 790 By+ medium and cultivated at 30 °C and 200 rpm for 24 h. Cell pellets were harvested and crushed by the liquid nitrogen grounding method. The total RNA of Aurantiochytrium limacinum MYA-1381 was then isolated with the Rapid Fungal RNA Extraction Kit (Coolaber Biotechnology, Beijing, China). Thermo Scientific NanoDrop 2000 spectrophotometer was applied to determine the quantity and quality of RNA extracts. With the removal of the residual genomic DNA, the cDNA was subsequently generated using the HiScript cDNA Synthesis Kit (Vazyme Biotechnology, Nanjing, China). Briefly, a 16 μL reaction consisting of 1 μg total RNA, 4 μL 4× gDNA wiper mix and optimal amount of RNase-free ddH2O was incubated at 42 °C for 2 min. Then, an additional 4 μL 5× HiScript III qRT SuperMix was added and the final 20 μL reaction mixture was incubated at 37 °C for 15 min to synthesize the cDNA. After cultivation at 37 °C and 200 rpm for 12 h, cell pellets of Escherichia coli BL21 (DE3) were harvested and crushed. Genomic DNA extraction from Escherichia coli was conducted with the TIANamp Bacteria DNA Kit (TIANGEN Biotechnology, Beijing, China).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!