Dna polymerase

Manufactured by Roche

Sourced in Germany

DNA polymerase is an enzyme responsible for catalyzing the synthesis of DNA molecules by adding nucleotides to a DNA strand. It is a crucial component in various molecular biology and genetic engineering applications.

Automatically generated - may contain errors

Lab products found in correlation

T4 dna ligase, by Roche (1 mentions) Dig dna labeling and detection kit, by Roche (1 mentions) Oligonucleotide, by Merck Group (1 mentions) Restriction enzymes, by Roche (1 mentions) Prset a vector, by Thermo Fisher Scientific (1 mentions) Pcr product purification kit, by Roche (1 mentions) T4 ligase, by Roche (1 mentions) Anti t7 tag antibody, by Abcam (1 mentions) Pbluescript 2 ks vector, by Thermo Fisher Scientific (1 mentions) Dna extraction kit, by Qiagen (1 mentions) Ampicillin, by Roche (1 mentions) Agarose gel extraction kit, by Roche (1 mentions) E coli bl21 de3, by Promega (1 mentions) Genescan 500 size standard, by Thermo Fisher Scientific (1 mentions) Hi di formamide, by Thermo Fisher Scientific (1 mentions) Abi prism 3100 genetic analyzer, by Thermo Fisher Scientific (1 mentions) Dntp mix, by New England Biolabs (1 mentions) Pcr purification kit, by Qiagen (1 mentions) Gel purification kit, by Qiagen (1 mentions)

Spelling variants of this product

HiFi HotStart DNA polymerase (11 citations) Expand High Fidelity Taq DNA polymerase (8 citations) KAPA DNA polymerase (4 citations) Fast start Taq DNA polymerase dNTP pack (3 citations) RTth DNA polymerase (2 citations) Phusion High Fidelity DNA Polymerase (2 citations) FastStart Taq DNA polymerase system (2 citations) KAPA2G Multiplex DNA Polymerase (2 citations) Pfu DNA Polymerase (2 citations) Taq DNA Polymerase kit (2 citations)

8 protocols using dna polymerase

Cloning and Expression of C. testosteroni

Check if the same lab product or an alternative is used in the 5 most similar protocols

C. testosteroni ATCC11996 (Deutsche Sammlung für Mikroorganismen). Plasmid pET-15b containing the ampicillin resistance gene (Shanghai qincheng biotechnology co. China). Escherichia coli (BL21, Promega, Madison, USA) and Plasmid pCR2.1-TOPO (Thermo Fisher Scientific, California, USA).
Ampicillin and kanamycin (Sangon, Shanghai, China). Restriction enzymes, DNA ligase, and DNA polymerase were obtained from Boehringer Mannheim, Biolabs, MBI, and Amersham, and used according to the manufacturers instructions. Recombinant DNA work was carried out following standard techniques, according to Sambrook and Russel.

Liu C., Liu K., Zhao C., Gong P, & Yu Y. (2020). The characterization of a short chain dehydrogenase/reductase (SDRx) in Comamonas testosteroni. Toxicology Reports, 7, 460-467.

+ Open protocol

+ Expand

Unwinding Assay for Circular DNA

Check if the same lab product or an alternative is used in the 5 most similar protocols

The substrate utilized in unwinding assays was made by annealing the 15-mer universal sequencing primer (U.S. Biochemical, Cleveland, OH) to srRNA) The primer was labeled with [α32P] dATP using DNA polymerase (Boehringer-Mannheim, Indianapolis, IN, USA). This resulted in single-stranded circular DNA with an 18 bp double-stranded region. The unwinding reaction was carried out by the method described previously [42 (link)]. Reactions were stopped by the addition of SDS to a final concentration of 0.3% and EDTA to a final concentration of 0.05 M. Samples were analyzed on 9% native polyacrylamide gels in 0.5X TBE buffer for 3 h at 160 V at room temperature to designate the displaced srRNA and the annealed substrate, respectively.

Darbinian N., Gallia G.L., Darbinyan A., Vadachkoria E., Merabova N., Moore A., Goetzl L., Amini S, & Selzer M.E. (2023). Effects of In Utero EtOH Exposure on 18S Ribosomal RNA Processing: Contribution to Fetal Alcohol Spectrum Disorder. International Journal of Molecular Sciences, 24(18), 13714.

+ Open protocol

+ Expand

Genetic Manipulation Techniques in Vibrio

Check if the same lab product or an alternative is used in the 5 most similar protocols

Plasmid isolation, restriction digestion, DNA ligation, transformation, DNA extraction, and PCR were carried out using standard protocols, as described elsewhere (Green and Sambrook, 2012 ). Restriction enzymes, T4 DNA ligase, DNA polymerase, and the DIG-DNA labeling and detection kit were from Roche (Roche NimbleGen, RRID:SCR_008571). The oligonucleotides used for this work are listed in Supplementary Material 1 and were purchased from Invitrogen (Molecular Probes, RRID:SCR_013318). Mutants of the V. spinosum recA promoter (VSP_RS32310) were obtained using oligonucleotides carrying designed substitutions (Supplementary Material 1). The DNA sequence of generated fragments was verified by sequencing (Macrogen, RRID:SCR_014454).

Erill I., Campoy S., Kılıç S, & Barbé J. (2016). The Verrucomicrobia LexA-Binding Motif: Insights into the Evolutionary Dynamics of the SOS Response. Frontiers in Molecular Biosciences, 3, 33.

+ Open protocol

+ Expand

MSI Determination in Tumor Samples

Check if the same lab product or an alternative is used in the 5 most similar protocols

The MSI status of each tumor was determined with the following five markers: BAT 25, BAT 26, D2S123, D5S346, and D17S250. Fifty nanograms of DNA were amplified in a 20 µL reaction solution containing 2 µL of 10X buffer (Roche, Mannheim, Germany), 1.7 to 2.5 mmol/L of MgCl₂, 0.3 µM of each primer pair, 250 µM of deoxynucleotide triphosphate, and 2.5 units of DNA polymerase (Roche). The primer sequences and polymerase chain reaction (PCR) cycles for each marker were adapted from the published data.25 (link) Fluorescence markers (NED, FAM) were attached to the 5' end of the forward primer.
All samples were prepared for fragment separation on an ABI Prism 3100 Genetic Analyzer using 0.7 µL of the amplified samples combined with 0.3 µL of GeneScan 500 Size Standard and 9 µL of HiDi Formamide.
MSI was diagnosed when there were aberrant peaks or peak shifts compared to the normal control. A case was categorized as MSI-H if MSI was present at two or more markers, MSI-low (MSI-L) if only one of the five markers showed instability, and microsatellite stable (MSS) if no marker had evidence of MSI.26 (link) In all of the analyses, MSI-L, and MSS tumors were grouped together and denoted as MSI-L/MSS.

Kang J., Lee H.W., Kim I.K., Kim N.K., Sohn S.K, & Lee K.Y. (2014). Clinical Implications of Microsatellite Instability in T1 Colorectal Cancer. Yonsei Medical Journal, 56(1), 175-181.

+ Open protocol

+ Expand

Generating Truncated FtsA Protein Variants

Check if the same lab product or an alternative is used in the 5 most similar protocols

Standard protocols for molecular cloning, transformation, and DNA analysis were performed as previously described (28 ). Oligonucleotides were purchased from Sigma-Aldrich and restriction enzymes and DNA polymerase from Roche Diagnostics.
Primers MK1 (5′ CGGGATCCATGGCTAGAGAAGGCTT 3′) and MK3 (5′ CGGAATTC TTAAGCTGTTTTTTGCAG 3′) were used to amplify the pRSETA_ftsA sequence (6 (link)), except the sequence encoding the last 52 amino acids of the FtsA C-terminal region from Gln406 to Glu457. The plasmid named pMKV1 bears the desired deletion to produce truncated FtsA lacking the C terminus, termed FtsAΔCt. A similar procedure was used to amplify the ftsAΔCt genes additionally lacking the sequence encoding domain 1C (ftsAΔCtΔ1C) or the S12 and S13 β sheets (ftsAΔCtΔS) from the pARV48 and pARV49 plasmids encoding FtsAΔ1C and FtsAΔS (5 (link)) to yield the plasmids pMKV12 and pMKV2, respectively.
Plasmids from pMKV29 to pMKV34 encoding FtsA and its deletion mutants (FtsAΔ1C, FtsAΔS, FtsAΔCt, FtsAΔCtΔS, and FtsAΔCtΔ1C, respectively), fused with mCherry at the N-terminal end, were obtained by inserting the mCherry gene into the pRSETA_ftsA, pARV48, pARV49, pMKV1, pMKV2 and pMKV12 plasmids, respectively, to span the His tag-encoding sequence derived from the pRSETA vector (Invitrogen). All mutations were confirmed by DNA sequencing.

Krupka M., Cabré E.J., Jiménez M., Rivas G., Rico A.I, & Vicente M. (2014). Role of the FtsA C Terminus as a Switch for Polymerization and Membrane Association. mBio, 5(6), e02221-14.

+ Open protocol

+ Expand

Cloning and Expression of Rhodococcus Enzymes

Check if the same lab product or an alternative is used in the 5 most similar protocols

Genomic DNA was obtained from Rhodococcus erythropolis IGTS8. The cloning vector and host were pBluescript II KS (+) vector (Fermentas) and E. coli DH5a cells (Novagen). Furthermore, the expression of wild-type and mutant enzymes was done by using the pET-23a (+) (Novagen) and E. coli BL21 (DE3) (Promega). DNA polymerase, Bam HI and Eco RI, T4 Ligase, Ampicillin from Roche Diagnostic (Germany); and DNA ladders, protein markers, T4 DNA ligase and anti-T7 tag antibody were purchased from Abcam Company. NADH and FMN sodium salts, and the IPTG- X-Gal were purchased from Sigma Company. The DNA extraction kit and high pure plasmid purification kit were obtained from Qiagen Company. The agarose gel extraction kit and the PCR product purification kit were obtained from the Roche company. The LB medium containing 100 μg/ml Ampicillin was used in the benchtop operations at 37 °C.

Fallahzadeh R., Bambai B., Esfahani K, & Sepahi A.A. (2019). Simulation-based protein engineering of R. erythropolis FMN oxidoreductase (DszD). Heliyon, 5(8), e02193.

+ Open protocol

+ Expand

Determination of Microsatellite Instability

Check if the same lab product or an alternative is used in the 5 most similar protocols

A set of microsatellite markers consisting of two mononucleotide repeat markers (BAT25 and BAT26) and three dinucleotide repeat markers (D2S123, D5S346, and D17S250), as recommended by the National Cancer Institute Consensus Group, were used to determine tumor the microsatellite instability (MSI) status. Aliquots containing 50 ng DNA were amplified in 20-µL reaction mixtures containing 2 µL of 10× buffer (Roche, Mannheim, Germany), 1.7–2.5 mmol/L MgCl₂, 0.3 µM each primer pair, 250 µM deoxynucleotide triphosphates, and 2.5 U DNA polymerase (Roche, Mannheim, Germany). PCR was performed with an initial denaturation step of 94°C for 5 min, followed by 30 cycles of 1 min at 94°C, 1 min at 55°C, and 1 min at 72°C and a final extension step of 10 min at 72°C. The samples were analyzed on an ABI Prism 3100 Genetic Analyzer using 0.7 µL of amplified sample combined with 0.3 µL of GeneScan 500 Size Standard and 9 µL of HiDi Formamide according to the manufacturer's guidelines (Applied Biosystems, Foster City, CA, USA). Data were analyzed using ABI Prism 3100 Data Collection software (Applied Biosystems, Foster City, CA, USA).

Lee S.Y., Haq F., Kim D., Jun C., Jo H.J., Ahn S.M, & Lee W.S. (2014). Comparative Genomic Analysis of Primary and Synchronous Metastatic Colorectal Cancers. PLoS ONE, 9(3), e90459.

+ Open protocol

+ Expand

Amplicon Sequencing of nifH Genes

Check if the same lab product or an alternative is used in the 5 most similar protocols

A total of 23 samples instead of 24 were subjected to 454 pyrosequencing due to insufficient remaining DNA and soil for one of the samples. Amplification was performed using the nifH PolF/PolR primers (PoLF: TGCGAYCCSAARGCBGACTC and PolR: ATSGCCATCATYTCRCCGGA), whose products are expected to be approximately 362 bp [32] . A unique 8mer barcode was added for each sample at the 5′-end of the forward primer. The barcode primers were synthesized by Invitrogen (Carlsbad, CA, USA) and used for the generation of PCR amplicons. Quadruplicate 20-μl PCR reactions were performed as follows: 4 μl Promega GoTaq buffer, 1 U DNA polymerase, 1.5 μl Roche 25 mM MgCl 2 , 1 μl Invitrogen 10 mM dNTP mix, 1 μl of each primer (10 μM), 0.2 μl New England BioLabs BSA (non-acetylated, 10 mg/ml), 10 ng template, and 9.8 μl H 2 O. Cycling conditions were an initial denaturation of 94 °C for 3 min, 30 cycles of 94 °C for 1 min, 62 °C for 40 s, 72 °C for 1 min, and a final extension at 72 °C for 10 min. PCR products were gel-purified using the Qiagen Gel Purification Kit following band excision. Products were further purified using the Qiagen PCR purification kit. After adapter ligation, amplicons were sequenced on a FLX 454 system (454 Life Sciences, Branford, CT, USA) by Macrogen (Seoul, South Korea) using Lib-L kits and processed using the shotgun protocol.

Tu Q., Zhou X., He Z., Xue K., Wu L., Reich P., Hobbie S, & Zhou J. (2016). The Diversity and Co-occurrence Patterns of N₂-Fixing Communities in a CO₂-Enriched Grassland Ecosystem. Microbial ecology, 71(3).

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!