Viral load was measured by quantitative real-time PCR (qRT-PCR) on RNA extracted from the supernatant of lung homogenates as reported previously (35 (link)). Briefly, lung homogenates were prepared by homogenizing perfused lung using an electric homogenizer. The inactivated samples were transferred from the BSL-3 to BSL-2 laboratory and total RNA was extracted from the collected supernatant. Each RNA sample was reverse transcribed to 50 μl cDNA with HiScript II Q RT SuperMix for qPCR (+gDNA wiper) (R223-01). Approximately 5 μl cDNA was added into a 25 μl qRT-PCR reaction containing the ChamQ SYBR qPCR Master Mix (High ROX Premixed) (Q341-02, Vazyme Biotech, China) and primers designed to target the nucleocapsid protein of SARS-CoV-2 (5′- GGGGAACTTCTCCTGCTAGAAT -3′ and 5′- CAGACATTTTGCTCTCAAGCTG -3′). The samples were run in triplicate on an ABI 7900 Real-Time System (Applied Biosystems, Thermo Fisher Scientific). The following cycling conditions were performed: 1 cycle of 50°C for 2 min, 1 cycle of 95°C for 10 min, and 40 cycles of 95°C for 15 s and 58°C for 1 min.
Abi7900 real time system
Manufactured by Thermo Fisher Scientific
Sourced in United States
The ABI7900 is a real-time PCR system designed for gene expression analysis and quantification. It provides accurate and reliable data for a variety of applications, including gene expression profiling, target validation, and SNP genotyping. The system features advanced optical detection, precise thermal control, and user-friendly software, enabling efficient and high-throughput data acquisition and analysis.
Automatically generated - may contain errors
Lab products found in correlation
Trizol reagent, by Thermo Fisher Scientific (3 mentions)
Maxima h minus first strand cdna synthesis kit, by Thermo Fisher Scientific (3 mentions)
Reverse transcription kit, by Takara Bio (2 mentions)
Nanodrop 2000, by Thermo Fisher Scientific (2 mentions)
Chamq sybr qpcr master mix high rox premixed, by Vazyme (1 mentions)
Primescript 1st strand cdna synthesis kit, by Takara Bio (1 mentions)
Sybr green pcr master mix kit, by Takara Bio (1 mentions)
Rt pcr prime script kit, by Takara Bio (1 mentions)
Taqman universal pcr master mix, by Thermo Fisher Scientific (1 mentions)
Sybr premix ex taq, by Thermo Fisher Scientific (1 mentions)
Qiaquick pcr purification kit, by Qiagen (1 mentions)
Rnaiso plus, by Takara Bio (1 mentions)
Primer express 3, by Thermo Fisher Scientific (1 mentions)
Sybr green pcr master mix, by Thermo Fisher Scientific (1 mentions)
Superscript 3 reverse transcriptase, by Thermo Fisher Scientific (1 mentions)
8 protocols using abi7900 real time system
1
SARS-CoV-2 Viral Load Quantification
2
Extraction and Quantification of RNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted using TRIzol reagent (Invitrogen; Thermo Fisher Scientific, Inc.) according to the manufacturer's protocol, and the concentration of total RNA was determined using NanoDrop 2000 (Thermo Fisher Scientific, Inc.). cDNA synthesis for the detection of target genes and miRNA was performed with 1 µg total RNA using PrimeScript™ 1st Strand cDNA Synthesis kit (Takara Bio, Inc., Otsu, Japan) according to the manufacturer's protocol. The mRNA expression levels of Fas cell surface death receptor (Fas), caspase-3, caspase-8, Bcl-2-associated X protein (Bax), Bcl-2 and GAPDH, and the expression levels of miR-98 and U6 were analyzed using SYBR Green PCR Master Mix kit (Takara Bio, Inc.) according to the manufacturer's protocol. Primer sequences are presented in Table I . All oligonucleotide primers were synthesized by Sangon Biotech Co., Ltd. (Shanghai, China). qPCR reactions (denaturation: 95°C, 30 sec 1 cycle; PCR reaction: 95°C, 5 sec, 60°C, 40 sec 45 cycles) were performed on an ABI7900 Real-Time system (Applied Biosystems; Thermo Fisher Scientific, Waltham, MA, USA). The Cq values were analyzed using the comparative Cq (ΔΔCq) method (18 (link)) and the quantity of target mRNA was obtained by normalizing to the endogenous references (GAPDH or U6), relative to the control. All experiments were repeated at least six times.
3
SARS-CoV-2 Quantitative Real-Time PCR Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Viral load was detected by quantitative real-time PCR (qRT-PCR) on RNA extracted from the supernatant of lung homogenates as described previously (Cao et al., 2020 (link)). Briefly, lung homogenates were prepared by homogenizing perfused whole lung using an electric homogenizer. The supernatant was collected, and total RNA was extracted. Each RNA sample was reverse transcribed to 50 μL cDNA with RT-PCR Prime Script Kit (Takara). The cDNA (5 μl) was used in a 25 μL qRT-PCR reaction with the TaqMan Universal PCR Master Mix (Life Technologies), a TaqMan probe (5′-FAM− CAGGTGGAACCTCATCAGGAGATGC −MGB-3′), and primers designed to target the orf1ab gene of SARS-CoV-2 (5′- GTGARATGGTCATGTGTGGCGG −3′ and 5′- CARATGTTAAASACACTATTAGCATA −3′). The samples were run in triplicate on an ABI 7900 Real-Time System (Applied Biosystems, Thermo Fisher Scientific). The following cycling conditions were used: 1 cycle of 50°C for 2 min, 1 cycle of 95°C for 10 min, and 40 cycles of 95°C for 15 s and 58°C for 1 min. The virus titer was determined by comparison with a standard curve generated using RNA extracted from a serially diluted reference viral stock. All experiments were performed in a Biosafety Level 3 facility.
4
Quantitative Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated from cultured cells using TRIzol reagent (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s instructions. The reverse transcription of RNA to complementary DNA (cDNA) was performed using a reverse transcription kit (Takara, Dalian, China). Quantitative reverse transcriptase-polymerase chain reaction (qRT-PCR) was conducted on an ABI7900 real-time system (Applied Biosystems, Foster City, CA, USA) to analyze the expression levels of target genes. Gene-specific primers were utilized, and their details sequence can be found in Table 2 . β-actin was used as an internal control for analysis, and the relative expression of mRNAs was determined using the comparative Ct method [36 (link)].
5
ChIP-qPCR Analysis of Arabidopsis BV1-ECFP
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
About 2 g of 14-day old Arabidopsis seedlings expressing 35S:BV1-ECFP was used. Seedlings treated with 50 μM MG132 overnight were used for chromatin preparation and immunoprecipitation. Immunoprecipitation was performed by adding GFP-agrose beads (GFPtrack). After washing, immune complexes were eluted from protein A beads and reverse cross-linked by incubation for at least 6 h at 65°C. Samples were treated with proteinase K for 1 h at 65°C. DNA was extracted in a final volume of 80 μL using the QIAquick PCR purification kit (Qiagen). ChIP assay was repeated with 3 biological replicates. One microliter of DNA was used for each real-time quantitative PCR with SYBR Premix Ex Taq (Applied Biosystems, USA) in the ABI7900 real-time system (Applied Biosystems, USA). Each sample was assayed in triplicate by PCR. Error bars in each graph indicate standard deviation (SD) of three biological replicates. We used ACTIN2 as an internal control. Primers used for ChIP assays are listed in S1 Table
6
Quantitative Analysis of Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA from different tissues was extracted using RNA extraction kit (RNAiso Plus, TaKaRa). RNA quality was monitored by gel electrophoresis and the measurement of the A260/A280 ratio. For cDNA synthesis, 1.0 μg RNA was reverse-transcribed using Maxima H Minus First Strand cDNA Synthesis Kit (Thermo Scientific) and oligo-dT primers according to the manufacturer’s procedure. Primer pairs were designed to amplify specific CSGs and Orphan genes using Primer Express 3.0 software (Applied Biosystems, Foster City, CA, USA). The primer sequences were shown in detail in Additional file 7 . QRT-PCR was conducted on ABI 7900 Real Time System (Applied Biosystems) using SYBR Green PCR Master Mix (Applied Biosystems). The reactions were performed with the following cycling profile: 50 °C for 2 min and 95 °C for 1 min, followed by 40 cycles of 95 °C/ 15 s, 60 °C/ 60 s. Melting curve analysis was performed to verify the specificity of the amplicon for each primer pair. With the citrus β-Actin gene as the internal reference gene, relative gene expression values were calculated using the 2-ΔΔCt method [51 (link)].
7
RNA Extraction and RT-qPCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from tissues or cultured cells using TRIzol reagent (Invitrogen, Carlsbad, CA). For qRT-PCR, RNA was reverse transcribed to cDNA by using a reverse transcription kit (Takara, Dalian, China). The ABI7900 real-time system (Applied Biosystems, USA) was utilized for quantitative reverse transcriptase-PCR reaction. The gene-specific primers are shown in Supplementary Table 2 . β-actin was employed as a loading control for mRNA and lncRNA. For microRNA analysis, real-time qPCR was performed as above, and the relative expression of RNAs was calculated using the comparative Ct method.
8
Quantitative miRNA Expression Profiling
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The expression patterns of miRNAs in different samples were tested using stem-loop qPCR method [64 ]. cDNAs were reverse transcribed from total RNAs using SuperScript III Reverse Transcriptase (Invitrogen, USA). PCR was performed using 0.5 μl of cDNA products and 5 μl of SYBR GREEN PCR Master mix and 0.5 μM forward and reverse primers in a 10 μl total reaction system. The reaction program was performed on the ABI 7900 Real Time System (Applied Biosystems, USA) in a program at 50 for 2 min and 95 for 1 min, followed by 40 cycles at 95 for 15 s and 60 for 1 min. Two biological replicates in two years were conducted and U6 was used as the endogenous control [65 (link)]. The stem-loop primers were listed in Additional file 6 .
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!