Log In Sign up
The largest database of trusted experimental protocols

C1000 thermal cycler system

Manufactured by Bio-Rad
Visit Supplier
Sourced in Japan

The C1000 Thermal Cycler system is a programmable thermal cycler used for DNA amplification. It has a temperature range of 4°C to 100°C and can hold up to 96 samples. The thermal cycler utilizes Peltier technology for rapid and precise temperature control.

Automatically generated - may contain errors

Lab products found in correlation

Purelink rna mini kit, by Thermo Fisher Scientific (2 mentions) Nanodrop 1000, by Thermo Fisher Scientific (2 mentions) Sybr premix ex taqtm 2 kit, by Takara Bio (1 mentions) Mirna 1st strand cdna synthesis kit, by Accurate Biology (1 mentions) Primescript rt master mix kit, by Takara Bio (1 mentions) Cfx96 real time system, by Bio-Rad (1 mentions) Ultrasybr mixture, by CWBIO (1 mentions) Random primer mix, by New England Biolabs (1 mentions) Cfx96 real time pcr detection system, by Bio-Rad (1 mentions) Amplification grade dnase 1, by Merck Group (1 mentions) Itaq universal sybr green supermix, by Bio-Rad (1 mentions) Steponeplus real time pcr detection system, by Thermo Fisher Scientific (1 mentions) Taqman rna to ct 1 step kit, by Thermo Fisher Scientific (1 mentions) Cfx96 real time detection system, by Bio-Rad (1 mentions) Ssofast evagreen supermix, by Bio-Rad (1 mentions) Sybr green dye, by Bio-Rad (1 mentions) Mammalian total rna miniprep kit, by Merck Group (1 mentions) High capacity cdna reverse transcription kit, by Thermo Fisher Scientific (1 mentions) Sybr green qpcr kit, by Takara Bio (1 mentions)

8 protocols using c1000 thermal cycler system

1

Quantification of Gene and miRNA Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols
The concentration of RNA lysates was measured (Epoch, BioTek instruments, Inc.). For reverse transcription, 500 ng RNA for synthesizing cDNA with Prime Script™ RT Master Mix kit (Takara, Japan), while 800 ng miRNAs with miRNA 1st strand cDNA synthesis kit (Accurate biology, Changsha) on a C1000™ Thermal Cycler system (Bio-Rad). The amplification of cDNA was executed with SYBR Premix Ex TaqTM II kit (Takara, Japan) or UltraSYBR mixture (Cwbio, Beijing) on a CFX96™ Real-Time System (Bio-Rad). Genes expression was confirmed by performing every reaction in triplicate, with regarding GAPDH as an inner control. U6 was utilized as an internal normalization for mir-486-3p. The primer pairs appeared in the experiment were documented in Table 1, with each experiment being replicated thrice. Relative quantification was conducted following the ΔΔCT method, and results were represented in the linear form using the formula 2-ΔΔCT.
Li Y., Xiao Y., Shang Y., Xu C., Han C., Hu D., Han J, & Wang H. (2024). Exosomes derived from adipose tissue-derived stem cells alleviated H2O2-induced oxidative stress and endothelial-to-mesenchymal transition in human umbilical vein endothelial cells by inhibition of the mir-486-3p/Sirt6/Smad signaling pathway. Cell Biology and Toxicology, 40(1), 39.
+ Open protocol
+ Expand
2

qPCR Analysis of Mouse and Human Genes

Cited 1 time
Check if the same lab product or an alternative is used in the 5 most similar protocols
The cDNA generated from mouse tissues and human colon cancer cells was used for qPCR as previously described.19 (link), 20 (link) The following primers (Thermo Fisher Scientific) were used for amplification of human and mouse cDNA: Itga2 (human: hItga2-FOR 5′-GGTGCTCCTCGGGCAAATTA-3′, hItga2-REV 5′-GAGCCAATCTGGTCACCTCG-3′; mouse: mItga2-FOR 5′-TGGTAGTTGTGACCGATGGC-3′; mItga2-REV 5′-ACCCAAGAACTGCTATGCCG-3′), Adamts12 (mAdamts12-FOR 5′-CTGCCAAGGACTGACTGGATT-3′, mAdamts12-REV 5′-GTAGGACCCTTCCTCGGTCA-3′), St8sia5 (mSt8sia5-FOR 5′-CTTGTCCAGGTGCTGCAATG-3′; mSt8sia5-REV 5′-AGGGCATTTCCTTGGGAAACA-3′), Tlr4 (mTlr4-FOR 5′-AATCCCTGCATAGAGGTAGTTCC-3′, mTlr4-REV 5′-ATCCAGCCACTGAAGTTCTGA-3′), FOXO3 (hFoxo3-FOR 5′-TGGTTTGAACGTGGGGAACT-3′, hFoxo3-REV 5′-GTGTCAGTTTGAGGGTCTGCT-3′). To determine the relative levels of mRNA the comparative Ct method was used with Hprt-1 as a housekeeping control. The C1000 Thermal Cycler system (Bio-Rad, Hercules, CA) and iQ SYBR Green DNA double-strand binding dye (iQ SYBR Green Supermix; Bio-Rad; 1708885) were used to quantify cDNA. As expected, PCR amplification was unaffected in mouse colonic tumors because of ample time between the last DSS treatment and RNA extraction.21 (link)
Penrose H.M., Cable C., Heller S., Ungerleider N., Nakhoul H., Baddoo M., Hartono A.B., Lee S.B., Burow M.E., Flemington E.F., Crawford S.E, & Savkovic S.D. (2018). Loss of Forkhead Box O3 Facilitates Inflammatory Colon Cancer: Transcriptome Profiling of the Immune Landscape and Novel Targets. Cellular and Molecular Gastroenterology and Hepatology, 7(2), 391-408.
+ Open protocol
+ Expand
3

Quantitative RT-PCR Analysis of Collagen Transcripts

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was extracted from 10 to 12 μ-masses using TRIzol reagent (GIBCO-BRL/ Invitrogen by Life Technologies, Grand Island, NY, USA). Reverse transcriptase-polymerase chain reaction (RT-PCR) was performed with a SuperScript II reverse transcriptase (Invitrogen by Life Technologies, Grand Island, NY, USA) and random primer mix (NEB, Ipswich, MA, USA). For qPCR, C1000 thermal cycler system with CFX96 real-time PCR detection systems (Bio-Rad, Hercules, CA, USA) and IQTM SYPR® Green supermix (Bio-Rad, Hercules, CA, USA) were used with the following primers: type II collagen (forward, 5'-CCCTGAGTGGAAGAGTGGAG-3', reverse, 5'-GAGGCGTGAGGTCTTCTGTG-3'), type I collagen (forward, 5'-CGATGGCTGCACGAGTCACAC-3', reverse, 5'-CAGGTTGGGATGGAGGGAGTTTAC-3'), GAPDH (forward, 5'- TCGACAGTCAGCCGCATCTTCTTT-3', reverse, 5'-ACCAAATCCGTTGACTCCGACCTT-3'). The relative mRNA levels were evaluated using the 2ΔΔC(t) method.
Yoon H.J., Kim S.B., Somaiya D., Noh M.J., Choi K.B., Lim C.L., Lee H.Y., Lee Y.J., Yi Y, & Lee K.H. (2015). Type II collagen and glycosaminoglycan expression induction in primary human chondrocyte by TGF-β1. BMC Musculoskeletal Disorders, 16, 141.
+ Open protocol
+ Expand
4

Quantifying mRNA Expression via qPCR

Check if the same lab product or an alternative is used in the 5 most similar protocols
Tissue RNA was isolated using lysis buffer from PureLink RNA mini kit (Thermo Fisher Scientific) per manufacturer’s protocol. RNA quantity and quality were assessed using a ThermoScientific Nanodrop 1000. Extracted RNA was DNase treated using Amplification Grade DNase 1 (Sigma-Aldrich) and cDNA was generated from 500ng of total RNA with Multiscribe reverse transcriptase and random hexameters (Thermo Fisher Scientific) into a 25μl reaction volume. Real-time qPCR was performed in triplicates in a Bio-Rad C1000 Thermal cycler system using iTaq Universal SYBR GreenSupermix (Bio-Rad) and gene-specific primers. Primers were ordered from Sigma-Aldrich and are listed in Table 1. Relative mRNA expression for genes of interest was assessed in comparison with control samples, following normalization to the reference genes α-tubulin (Tuba1), β2 microglobulin (B2m), and β-actin (Actb) using the ΔΔCT method as described in Applied Biosystems User Bulletin No. 2 (P/N 4303859) (Livak and Schmittgen, 2001 ). Appropriateness of reference genes was tested using NormFinder (version 20) (Andersen et al., 2004 (link)). The relative quantification data are presented in graphs showing fold increase expression ratio relative to control samples with error bars corresponding to the S.E.M. Statistical analysis was performed on biological replicates.
Voss J.J., Stermer A.R., Ghaffari R., Tiwary R, & Richburg J.H. (2018). MEHP-Induced Rat Testicular Inflammation Does Not Exacerbate Germ Cell Apoptosis. Reproduction (Cambridge, England), 156(1), 35-46.
+ Open protocol
+ Expand
5

Quantifying Gene Expression with RT-PCR

Check if the same lab product or an alternative is used in the 5 most similar protocols
Real-time RT-PCR was performed on 2–25 ng RNA using the Applied Biosystems TaqMan RNA-to-CT 1-Step Kit, and either a StepOnePlus Real-Time PCR detection system (Applied Biosystems) or a C1000 Thermal Cycler system (Bio-Rad). For each sample, fold induction was normalized to the content of 18 s rRNA and expressed as fold-induction relative to a control group. The primers and TaqMan probe sets were designed with the CLC Genomics Workbench software (CLC bio) with the following sequences: Zfp36l1 forward 5′ GCTTTCGAGACCGCTCTTTCT 3′, reverse 5′ GGCACTTGTCCCCGTACTT 3′ and probe 5′ CAACTCCAGCCGCTACAAGACGG 3′; Zfp36 forward 5′ CGAGAGCCTCCAGTCGATGAG 3′, reverse 5′ GGATGGAGTCCGAGTTTATGTTCCAA 3′, and probe 5′ CCGACCACGGAGGAACCGAATCCCT 3′. IL-10 forward 5′ GCCCAGAAATCAAGGAGCATTTG 3′, reverse 5′ TTCACAGGGGAGAAATCGATGAC 3′ and probe 5′ AGCCGCATCCTGAGGCTGTTCAGC 3′ The TaqMan primer and probe sets for IL-6, TNF- α, IL-1β and 18 s rRNA have already been described [56] (link), [57] (link).
Hyatt L.D., Wasserman G.A., Rah Y.J., Matsuura K.Y., Coleman F.T., Hilliard K.L., Pepper-Cunningham Z.A., Ieong M., Stumpo D.J., Blackshear P.J., Quinton L.J., Mizgerd J.P, & Jones M.R. (2014). Myeloid ZFP36L1 Does Not Regulate Inflammation or Host Defense in Mouse Models of Acute Bacterial Infection. PLoS ONE, 9(10), e109072.
+ Open protocol
+ Expand
6

Quantitative Real-Time PCR for miRNA-33a

Check if the same lab product or an alternative is used in the 5 most similar protocols
Real-time PCR reactions were carried out in duplicate using a Bio-Rad C1000™ thermal cycler system (CFX-96 Real-Time detection system, Bio-Rad). To monitor cDNA amplification, a fluorogenic DNA binding dye, EvaGreen (SsoFAST EvaGreen Supermix, Bio-Rad Laboratories Inc., Hercules, CA, USA), was used.
The miR-33a primer sequence was synthesized by Sigma Aldrich (Milan, Italy). In particular, the GenBank accession number for hsa-miR-33a was NR_029507, and the forward primer sequence (5′—3′) was CAATGTTTCCACAGTGCATCAC. The Ce_miR-39 (miRNA mimic Ce_miR-39_1 miScript Primer Assay) was employed to normalize miRNA data. All experiments were carried out according to the MIQE (Minimum Information for publication of Quantitative Real-Time PCR Experiments) guidelines [42 (link)].
Cabiati M., Guiducci L., Randazzo E., Casieri V., Federico G, & Del Ry S. (2023). Circulating and Exosomal microRNA-33 in Childhood Obesity. Biomedicines, 11(8), 2295.
+ Open protocol
+ Expand
7

Quantifying BmCPV Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was extracted from the third instar larvae and BmN cells, infected with BmCPV, according to the standard protocol. The quantity and quality of RNA was determined with both 260/280 absorbance ratio and gel electrophoresis, respectively. RNA was stored at − 80 °C for further experiments. 1 μg of total RNA was used as template in the first-strand cDNA synthesis. Real-time quantitative PCR was performed using SYBR Green dye (Bio-Rad, Hong Kong, China) with C1000 Thermal Cycler System (Bio-Rad, Hercules, CA, USA). The primers for the genes expression analysis are listed in Table 2. The 2− ΔΔCT method was used for determination of relative expression level of the detected genes (Livak & Schmittgen, 2001 (link)). Experiments were performed in triplicates for each sample.

Primers for real-time PCR.

Table 2
Gene namePrimer nameSequence
vp7vp7-F5′-CAGGCAGAACCGCAACTATC-3′
vp7-R5′-GGTGATGCTCGTTCGTGGTGT-3′
vp1vp1-F5′-GGTCTCGACGTGAATACCGA-3′
vp1-R5′-TCGTCTGCTTCACTAGCACG-3′
β-actinβ-actin-F5′-AACACCCCGTCCTGCTCACTG-3′
β-actin-R5′-GGGCGAGACGTGTGATTTCCT-3′
He L., Hu X., Zhu M., Liang Z., Chen F., Zhu L., Kuang S., Cao G., Xue R, & Gong C. (2017). Identification and characterization of vp7 gene in Bombyx mori cytoplasmic polyhedrosis virus. Gene, 627, 343-350.
+ Open protocol
+ Expand
8

Quantitative RT-PCR Analysis of Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was extracted with a Mammalian Total RNA Miniprep kit (Cat# RTN350-1KT, Sigma Aldrich). RNA was denatured in the presence of an oligo dT primer and then reverse transcribed with a High Capacity cDNA Reverse Transcription kit (Cat# 4368814, Applied Biosystems, San Francisco, U.S.A.). qPCR was performed with a SYBR Green qPCR kit (Cat# 639676, Takara Bio., Shika, Japan) and C1000 Thermal Cycler system (Bio-Rad, Hercules, USA) with the sets of primers described in Supplementary Table 2, and relative mRNA expression levels were calculated with the comparative cycle threshold (Ct value) method and were normalized with Gapdh mRNA expression level.
Tang C., Sun H., Kadoki M., Han W., Ye X., Makusheva Y., Deng J., Feng B., Qiu D., Tan Y., Wang X., Guo Z., Huang C., Peng S., Chen M., Adachi Y., Ohno N., Trombetta S, & Iwakura Y. (2023). Blocking Dectin-1 prevents colorectal tumorigenesis by suppressing prostaglandin E2 production in myeloid-derived suppressor cells and enhancing IL-22 binding protein expression. Nature Communications, 14, 1493.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!