The Evolutionary Conserved Region web platform (ECR; http://ecrbrowser.dcode.org ) was used to identify RBPJ motifs in the Gpr126 gene. Two conserved RBPJ-binding sites were found in the intronic region, flanking the fifth and sixth exon of human, monkey, rat and mouse Gpr126. In human the conserved RBPJ sites are separated by 445 base pairs (bp). Genomic DNA from HUVEC was used as a template to amplify 726 bp of GPR126 containing the two conserved sites and the product was cloned into the KpnI and XhoI sites of the pGL3 promoter luciferase plasmid (Promega). The primer sequences were: 5′-ATGCGGTACC ATTTATACTTGTTACTGTGC-3′ (forward, KpnI site underlined) and 5′-ATCGCTCGAG GGCCAAGAATTATAAAGAATGAG-3′ (reverse, XhoI site underlined). For luciferase assays we transiently co-transfected BAEC with the hGPR126 reporter plasmid (pGL3-hGPR126-Luciferase), Renilla plasmid, and increasing amounts of vector expressing the intracellular domain of Notch1 (0–200 ng) (pCS2-N1ICD). Twenty-four hours after transfection the cells were lysed, and luciferase activity was measured with the Dual Luciferase Assay System (Promega).
Pgl3 luciferase promoter plasmid
Manufactured by Promega
Sourced in United States
The PGL3 luciferase promoter plasmid is a DNA construct that contains the firefly luciferase reporter gene under the control of a promoter sequence. This plasmid can be used to study gene expression and transcriptional regulation in various experimental systems.
Automatically generated - may contain errors
Lab products found in correlation
Lipofectamine 2000, by Thermo Fisher Scientific (4 mentions)
Dual luciferase reporter assay system, by Promega (4 mentions)
Lipofectamine 3000, by Thermo Fisher Scientific (4 mentions)
Dual luciferase reporter gene assay kit, by Promega (2 mentions)
Dual luciferase reporter assay kit, by Promega (2 mentions)
Dual luciferase assay system, by Promega (1 mentions)
Pentr vector, by Thermo Fisher Scientific (1 mentions)
Sanger sequencing, by Source Bioscience (1 mentions)
M sssi, by New England Biolabs (1 mentions)
Pcpgfree promoter lucia plasmid, by InvivoGen (1 mentions)
Prl tk, by Promega (1 mentions)
Xbai restriction enzyme, by New England Biolabs (1 mentions)
Ecori restriction enzyme, by New England Biolabs (1 mentions)
Gibson assembly master mix, by New England Biolabs (1 mentions)
Hindiii, by New England Biolabs (1 mentions)
Luciferase assay kit, by Promega (1 mentions)
Luciferase reporter plasmid, by Promega (1 mentions)
Lipofectamine 2000, by Promega (1 mentions)
13 protocols using pgl3 luciferase promoter plasmid
1
Conserved RBPJ Binding Sites in GPR126
2
Cloning and Characterization of NINJ2 Regulatory Region
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The predicted 1020 bp length C/EBP beta binding region flanking rs34166160 in the first intron of NINJ2 (Chr12:622,453-623,472, hg38) was generated by PCR and using human genomic DNA as a template. The primer sequences used for amplification are 5′-GAGCTC GGGCTACCTAAAGAGAGGAAGA-3′ contained a Sac I restriction enzyme cutting site and 5′-CTCGAG CTTCCCTGATTTTGGCTGGTAC-3′ contained a Xho I site. The 1020 bp length PCR products were digested with Sac I and Xho I, and sub-cloned into the pGL3-Promoter luciferase plasmid (Promega, Madison, WI, USA), resulting in the pGL3-promoter-1020 bp-A or pGL3-promoter-1020 bp-C plasmid. The 30 bp length fragments flanking rs34166160 was synthesized by Genewiz ltd (Suzhou, China). The DNA fragment (5′-CGGGGTACC TCTGTCCCCCTCCCCCACTGCTACCCGAGCCTCGAGCGG -3′ for C allele of rs34166160 and 5′-CGGGGTACC TCTGTCCCCCTCCCCAACTGCTACCCGAGCCTCGAGCGG -3′ for A allele of rs34166160) and their corresponding complement chains were annealed and then sub-cloned into the pGL3-Promoter luciferase plasmid after digesting by Kpn I and Xho I. Human C/EBP beta ORF (NM_005194) was purchased from Origene (Rockville, MD, USA) and sub-cloned into pENTR vector (Thermo fisher, Pittsburgh, PA, USA).
3
Methylation-Dependent Promoter and Enhancer Activity
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
A 282 bp region encompassing the CpGs was amplified using genomic DNA and the insert was cloned into the pCpG-free-Basic-Lucia plasmid (Invivogen) to assess promoter function, and into the pCpG-free-Promoter-Lucia plasmid (Invivogen) to assess enhancer function (primer sequences available in Additional file 3 ). Successful cloning was determined by Sanger sequencing (Source Bioscience). Plasmids were methylated or mock-methylated using M.SssI (New England Biolabs). Tc28a2 immortalised chondrocytes [40 (link)] were seeded at a density of 5000 cells/well in 96-well plates and incubated for 24 h. Then, cells were transfected with 100ng insert DNA-vector constructs and 10ng pGL3-promoter-luciferase plasmid (Promega) using Lipofectamine 2000 (Invitrogen) and incubated. After 24 h, cells were lysed, and luminescence measured using the Dual Luciferase Reporter Assay system (Promega). Twelve biological replicates were performed per plasmid.
4
Validating miR-132-3p Regulation of GLRX
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The binding site of miR-132-3p and GLRX was predicted by the online prediction software StarBase (http://starbase.sysu.edu.cn/ ). The mutated type and wild-type sequences in the binding sites were designed and cloned into pGL3-Promoter luciferase plasmid (Promega), namely mut-GLRX and wt-GLRX. Then, mut-GLRX or wt-GLRX was cotransfected with miR-132-3p mimic or miR-132-3p inhibitor, respectively, into HEK-239T cells or pRL-TK (Promega). After that, Renilla luciferase activity and Firefly luciferase activity were determined by dual-luciferase reporter gene assay kit (Promega). Renilla luciferase activity was deemed as the internal control, and the ratio between the activities of Firefly luciferase and Renilla luciferase was calculated as the relative activity.
5
Cloning Luciferase Reporter Backbone
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The pGL3-promoter-luciferase plasmid (Promega) was linearized using the XbaI restriction enzyme (NEB). A 202-bp double-stranded DNA fragment (IDT) containing an EcoRI restriction enzyme site followed by a 36-bp spacer sequence was cloned into the pGL3-promoter vector by Gibson assembly using the Gibson Assembly Master Mix (NEB) (sequence of 202-bp double-stranded DNA fragment:
AAGTACCGAAAGGTCTTACCGGAAAACTCGACGCAAGAAAAATCAGAGAGATCCTCATAAAGGCCAAGAAGGGCGGAAAGATCGCCGTGTAATtctagagaattctcatgtaattagttatgtcacgcagatcggaagagcGTCGGGGCGGCCGGCCGCTTCGAGCAGACATGATAAGATACATTGATGAGTTTGGACAAAC).
Successfully assembled plasmids were verified by Sanger sequencing. This master luciferase reporter backbone was then digested with both HindIII and EcoRI restriction enzymes (NEB) according to the manufacturer’s instructions, and the larger fragment was gel excised, purified, and used as the backbone for cloning the PLUMAGE library.
AAGTACCGAAAGGTCTTACCGGAAAACTCGACGCAAGAAAAATCAGAGAGATCCTCATAAAGGCCAAGAAGGGCGGAAAGATCGCCGTGTAATtctagagaattctcatgtaattagttatgtcacgcagatcggaagagcGTCGGGGCGGCCGGCCGCTTCGAGCAGACATGATAAGATACATTGATGAGTTTGGACAAAC).
Successfully assembled plasmids were verified by Sanger sequencing. This master luciferase reporter backbone was then digested with both HindIII and EcoRI restriction enzymes (NEB) according to the manufacturer’s instructions, and the larger fragment was gel excised, purified, and used as the backbone for cloning the PLUMAGE library.
6
Characterizing KLF6 3'UTR Regulation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The pGL3 luciferase promoter plasmid (Promega) was used to generate constructs containing KLF6 3′-UTR [defined as wildtype (wt)]. The KLF6 3′-UTR mutation point [defined as mutant-type (mut)] that containing ac4C sites were directly synthesized using the QuickChange Multiple Site-directed Mutagenesis Kit (Stratagene). Afterwards, all designed plasmids were transfected into HGFs using the Lipofectamine 3000 method (Invitrogen). Fourty-eight hours after transfection, luciferase activities of harvested HGFs were detected by the Dual Luciferase Reporter Assay Kit (Promega). The ratio of firefly to Renilla luciferase activity was subsequently determined.
7
Validating lncRNA UCA1 Binding to miR-122
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
lncRNA UCA1 3′-UTR luciferase reporter binding with miR-122 target site was constructed. Segments of sequence were amplified using PCR and subcloned into the pGL3 luciferase promoter plasmid (Promega, Madison, WI, USA), respectively named pGL3-UCA1-WT and pGL3-UCA1-Mut. For the luciferase reporter gene assay, HEK293 cells were cultured in 24-well culture plates. Renilla luciferase acted as an internal control to normalize transfection efficiencies. The combined plasmids were transfected into HEK293 cells using Lipofectamine 2000 (Invitrogen) according to the manufacturer’s instructions. Firefly and Renilla luciferase activities were measured using the Dual-Luciferase Reporter Assay System (Promega).
8
Investigating PTPRG-AS1 miR-185-5p Interaction
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
A wild-type (WT) fragment of PTPRG-AS1 harboring the miR-185-5p binding site and their mutated (MUT) seed sequences were purchased from Genomeditech and cloned into the pGL3 luciferase promoter plasmid (Promega, Madison, WI, USA), namely PTPRG-AS1-WT and PTPRG-AS1-MUT, which were co-transfected with mimic negative control, miR-185-5p mimic, miR-185-5p inhibitor, and inhibitor negative control into 293T cells using lipofectamine 3000 (Thermo Fisher Scientific, Waltham, MA, USA). Cells were harvested at 48 h after transfection. The luciferase activity was measured using the Dual Luciferase Reporter Assay System (Promega) according the protocols.
9
Dual-Luciferase Assay for miR-31 Targeting
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Serial constructs containing circ_0000140 or LATS2 3′-UTR were generated using the pGL3 luciferase promoter plasmid (Promega Corporation, Madison, WI, USA). Point mutations of the miR-31-targeting sites in the circ_0000140 or LATS2 3′-UTR were directly synthesized using the QuickChange Multiple Site-directed Mutagenesis Kit (Stratagene, La Jolla, CA, USA). Each plasmid construct was subsequently co-transfected with miR-31 mimics, miR-31 inhibitors, and a corresponding negative control into Cal-27 and HSC-3 cells seeded in 12-well plates by using the Lipofectamine 2000 method (Invitrogen, Carlsbad, CA, USA). After transfection for 48 h, cells were harvested, and luciferase activities were detected by the Dual Luciferase Reporter Assay Kit (Promega). The ratio of firefly to Renilla luciferase activity was subsequently determined.
10
Constructing HOXA3 Luciferase Reporter Vectors
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To construct a luciferase reporter vector, the RNA sequence of wide-type HOXA3 (HOXA3-WT) was PCR-amplified and inserted into the pGL3 luciferase promoter plasmid (Promega Corporation, Madison, WI, USA). HOXA3 RNA sequence with mutations in the putative binding site (HOXA 3′-MUT) was also inserted into the pGL3 luciferase promoter plasmid and was chemically synthesized by Shanghai GenePharm Co., Ltd. Target cells were seeded in 96-well plates and reporter plasmids were co-transfected with either miR-10b mimics or a negative control using the Lipofectamin 3000 method. After 48 h of transfection, cells were lysed and the Firefly and Renilla luciferase activities were examined using the Dual-Luciferase Reporter Assay System (Promega).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!