The PyroMark PCR Kit (Qiagen, Hilden, Germany) was used for pyrosequencing with a forward primer (Pyro‐FOXL2‐F: 5′‐AGAAGGGCTGGCAAAATAGCATC‐3′) and reverse biotinylated primer (Pyro‐FOXL2‐R: 5′‐CCGGAAGGGCCTCTTCAT‐3′), or a reverse primer (Pyro‐FOXL2‐R2: 5′‐TAGTTGCCCTTCTCGAACATGTC‐3′) and a forward biotinylated primer (Pyro‐FOXL2‐F2: 5′‐CATCGCGAAGTTCCCGTTCTA‐3′). The PCR products were purified using streptavidin Sepharose HP beads (GE Healthcare, Buckinghamshire, UK), followed by hybridization with the sequencing primers (FOXL2‐seqF: 5′‐CGCAAGGGCAACTACT‐3′ or FOXL2‐seqR2: 5′‐CCTTCTCGAACATGTCT‐3′), as described in the PyroMark Q48 vacuum workstation guide (Qiagen). The sequencing data were analyzed using PyroMark Q48 software (Qiagen). The Pyrosequencing was performed and analyzed by Macrogen, Inc.
Pyromark q48 vacuum workstation guide
Manufactured by Qiagen
Sourced in United Kingdom
The PyroMark Q48 vacuum workstation is a laboratory instrument designed for the preparation and processing of samples for pyrosequencing analysis. It provides automated handling and preparation of samples, facilitating the workflow of pyrosequencing experiments.
Automatically generated - may contain errors
Lab products found in correlation
2 protocols using pyromark q48 vacuum workstation guide
1
Pyrosequencing of FOXL2 Gene
2
Pyrosequencing Analysis of FOXL2 Gene
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The PyroMark PCR Kit (Qiagen, Hilden, Germany) was used for pyrosequencing with a forward primer (Pyro-FOXL2-F: 5′-AGAAGGGCTGGCAAAATAGCATC-3′) and reverse biotinylated primer (Pyro-FOXL2-R: 5′-CCGGAAGGGCCTCTTCAT-3′), or a reverse primer (Pyro-FOXL2-R2: 5′-TAGTTGCCCTTCTCGAACATGTC-3′) and a forward biotinylated primer (Pyro-FOXL2-F2: 5′-CATCGCGAAGTTCCCGTTCTA-3′). The PCR products were purified using streptavidin
Sepharose HP beads (GE Healthcare, Buckinghamshire, UK), followed by hybridization with the sequencing primers (FOXL2-seqF: 5′-CGCAAGGGCAACTACT-3′ or FOXL2-seqR2: 5′-CCTTCTCGAACATGTCT-3′), as described in the PyroMark Q48 vacuum workstation guide (Qiagen). The sequencing data were analyzed using PyroMark Q48 software (Qiagen). The
Pyrosequencing was performed and analyzed by Macrogen, Inc.
Sepharose HP beads (GE Healthcare, Buckinghamshire, UK), followed by hybridization with the sequencing primers (FOXL2-seqF: 5′-CGCAAGGGCAACTACT-3′ or FOXL2-seqR2: 5′-CCTTCTCGAACATGTCT-3′), as described in the PyroMark Q48 vacuum workstation guide (Qiagen). The sequencing data were analyzed using PyroMark Q48 software (Qiagen). The
Pyrosequencing was performed and analyzed by Macrogen, Inc.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!