Log In Sign up
The largest database of trusted experimental protocols

Realplex 2 mastercyler

Manufactured by Eppendorf
Visit Supplier
Sourced in United States

The Realplex 2 Mastercyler is a real-time PCR instrument manufactured by Eppendorf. It is designed to perform quantitative polymerase chain reaction (qPCR) experiments. The Realplex 2 Mastercyler provides accurate temperature control and detection capabilities to facilitate DNA amplification and analysis.

Automatically generated - may contain errors

Lab products found in correlation

Take3 micro volume plate, by Agilent Technologies (1 mentions) Mirneasy kit, by Qiagen (1 mentions) Trizol reagent, by Thermo Fisher Scientific (1 mentions) Iscript, by Bio-Rad (1 mentions)

Spelling variants of this product

Realplex Mastercyler (4 citations)

2 protocols using realplex 2 mastercyler

1

Quantification of RPE/Choroid Gene Expression

Cited 1 time
Check if the same lab product or an alternative is used in the 5 most similar protocols
On day 6 following laser-induced CNV and day 11 following NaIO3-induced retinal degeneration, individual RPE/choroid fractions were isolated from mice and stored at –80°C until use. RNA was isolated using the miRNEASY Kit (Qiagen, Valencia, CA, USA). Absorbance A260/A280 ratio (Take 3 Micro-Volume Plates; Biotek, Winooski, VT, USA) was used to measure the purity of RNA, and samples with measurements of 1.8 to 2.1 were used to generate first-strand cDNA (Qiagen). Using the Realplex 2 Mastercyler (Eppendorf, Hauppauge, NY, USA), PCR amplifications for genes of interest (Table 1) were performed as previously described.47 (link) Quantitative values were obtained using cycle number (Ct value) with values normalized to either β-actin or 36B4.48 (link)
Schnabolk G., Obert E., Banda N.K, & Rohrer B. (2020). Systemic Inflammation by Collagen-Induced Arthritis Affects the Progression of Age-Related Macular Degeneration Differently in Two Mouse Models of the Disease. Investigative Ophthalmology & Visual Science, 61(14), 11.
+ Open protocol
+ Expand
2

Cardiac Transcript Quantification via qPCR

Check if the same lab product or an alternative is used in the 5 most similar protocols
Following flash freezing in liquid nitrogen, pulverized hearts were lysed in TRIzol-Reagent (Thermo Fisher Scientific) and mRNA was isolated using the Directzol RNA Miniprep Kit (Zymogen). cDNA was synthesized by reverse transcription of 1 μg mRNA using iScript (Biorad) and diluted 1:10. Transcripts were quantified by mixing PerfeCTASYBR Green (Quanta), 1μL diluted cDNA, and the appropriate primer sets followed by thermal cycling in an Eppendorf realplex2 Mastercyler. The following primer sequences listed in the 5′ to 3′ direction were used: L7 forward: GAAGCTCATCTATGAGAAGGC, L7 reverse: AAGACGAAGGAGCTGCAGAAC, Nppa forward: TCTTCCTCGTCTTGGCCTTT, Nppa reverse: CCAGGTGGTCTAGCAGGTTC, Nppb forward: CTCTGGGAAGTCCTAGCCAG, Nppb reverse: CTGCCTTGAGACCGAAGGAC, Myh7 forward: GAGCTGGGAAGACTGTCAAC, Myh7 reverse: CGAGAGGAGTTGTCATTCCG, Actal forward: CTGAGCGTGGCTATTCCTTC, Actal reverse: CATTGCCGATGGTGATGACC, Rcanl.4 forward: CATGCAGCGACAGACACCAC, Rcan1.4 reverse: GTGGATGGGTGTGTACTCCG.
Reynolds J.O., Quick A.P., Wang Q., Beavers D.L., Philippen L.E., Showell J., Barreto-Torres G., Theurauf D.J., Doroudgar S., Glembotski C.C, & Wehrens X.H. (2016). Junctophilin-2 gene therapy rescues heart failure by normalizing RyR2-mediated Ca2+ release. International journal of cardiology, 225, 371-380.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!