Log In Sign up
The largest database of trusted experimental protocols

Hdac6 sirna

Manufactured by Thermo Fisher Scientific
Visit Supplier
Sourced in United States

The HDAC6 siRNA is a laboratory reagent designed for gene expression research. It is a small interfering RNA (siRNA) molecule that targets the HDAC6 gene, which encodes a histone deacetylase enzyme. The HDAC6 siRNA can be used to temporarily reduce the expression of the HDAC6 gene in cell culture experiments, allowing researchers to study the cellular effects of HDAC6 knockdown.

Automatically generated - may contain errors

Lab products found in correlation

Lipofectamine rnaimax, by Thermo Fisher Scientific (2 mentions) Control sirna, by Thermo Fisher Scientific (2 mentions) Lipofectamine ltx, by Thermo Fisher Scientific (1 mentions) Caspase 3 antibody, by Cell Signaling Technology (1 mentions) Lipopolysaccharide lps from escherichia coli 0111 b4, by Merck Group (1 mentions) Lipofectamine rnaimax reagent, by Thermo Fisher Scientific (1 mentions) Ve cadherin antibody, by Santa Cruz Biotechnology (1 mentions) Recombinant human tnf α, by R&D Systems (1 mentions) Opti mem 1, by Thermo Fisher Scientific (1 mentions) Lipofectamine rnaimax transfection reagent, by Thermo Fisher Scientific (1 mentions) Rnaimax reagent, by Thermo Fisher Scientific (1 mentions) Pcdna5 to vector, by Thermo Fisher Scientific (1 mentions) Hdac6, by Qiagen (1 mentions)

Close spelling variants of this product

SiRNAs (258 citations) HDAC6 (6 citations)

5 protocols using hdac6 sirna

1

siRNA and Plasmid Transfection Protocols

Check if the same lab product or an alternative is used in the 5 most similar protocols
For siRNA transfections: 2 × 105 cells were seeded in 60 mm culture dishes 16 hrs before transfection with 500 pmol of siRNA using 7.5 μl of Lipofectamine RNAiMAX (Life Technologies). HDAC6-siRNA and control non-targeting siRNA (Life Technologies) were used at the same concentrations. Silencing efficiency was monitored by western blotting at 48 hrs after transfection. For plasmide transfections: 2 × 105 cells were seeded in 60 mm dishes 16 hrs before transfection with 2.5 μg of plasmid PPP1R2 pcDNA4/TO/myc-His A (Abgent, San Diego, CA, USA) - coding for the physiological PP1 inhibitor i.e. the protein phosphatase inhibitor 2 (I-2) [26 (link)] - using 7.5 μl of Lipofectamine LTX (Life Technologies); 24 hrs after transfection cells were incubated without/with 5 μM drug for additional 24 hrs.
Balliu M., Guandalini L., Romanelli M.N., D'Amico M, & Paoletti F. (2014). HDAC-inhibitor (S)-8 disrupts HDAC6-PP1 complex prompting A375 melanoma cell growth arrest and apoptosis. Journal of Cellular and Molecular Medicine, 19(1), 143-154.
+ Open protocol
+ Expand
2

Endothelial Permeability Regulation Assay

Check if the same lab product or an alternative is used in the 5 most similar protocols
β-actin, ZO-1, caspase-3 antibodies were purchased from Cell Signaling Technology (Danvers, Massachusetts). VE-cadherin antibody was obtained from Santa Cruz Biotechnology (Dallas, Texas). Recombinant Human TNF-α was from R&D Systems (Minneapolis, Minnesota). Tubastatin A, CAY10603 were obtained from Selleck Chemicals (Houston, Teaxs). Lipopolysaccharide (LPS) from Escherichia coli 0111:B4 was purchased from Sigma Aldrich (St. Louis, Missouri). Endothelial growth medium (EBM-2) was obtained from Lonza (Allendale, NJ). In Vitro Vascular Permeability Assay (96-Well) kit was purchased from EMD Millipore (Billerica, Massachusetts). Lipofectamine RNAiMAX reagent, HDAC6 siRNA and control siRNA were obtained from Life technologies (Carlsbad, California).
Yu J., Ma M., Ma Z, & Fu J. (2016). HDAC6 inhibition prevents TNF-α-induced caspase 3 activation in lung endothelial cell and maintains cell-cell junctions. Oncotarget, 7(34), 54714-54722.
+ Open protocol
+ Expand
3

HDAC6 Silencing in RPMI-8226 and H226 Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
For the gene silencing of HDAC6 in RPMI-8226 and H226 cells, HDAC6 siRNA and control siRNA were purchased from Life Technologies (Grand Island, NY, USA) and whose sequences are described as follows: HDAC6 sense, CCAGCACAGUCUUAUGGAUGCUAU and antisense, AUAGCCAUCCAUAAGACUGUGCUGG. siRNAs were diluted to a final concentration of 33 nM in Opti-MEM I (Life Technologies). Transfection was performed with the cells at 40% confluency using Lipofectamine RNAiMAX transfection reagent (Life Technologies) according to the manufacturer’s instructions. Knockdown efficiency was assessed by immunoblotting.
MORIYA S., KOMATSU S., YAMASAKI K., KAWAI Y., KOKUBA H., HIROTA A., CHE X.F., INAZU M., GOTOH A., HIRAMOTO M, & MIYAZAWA K. (2014). Targeting the integrated networks of aggresome formation, proteasome, and autophagy potentiates ER stress-mediated cell death in multiple myeloma cells. International Journal of Oncology, 46(2), 474-486.
+ Open protocol
+ Expand
4

TDP-43 Mutant Protocolome Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
Human TDP-43 was cloned into pCDNA5/TO vector (Invitrogen) and site-directed mutagenesis (Quikchange kit; Stratagene) was used to create K→Q or K→R mutations at residues K145 and K192 as indicated. Creb-binding protein (CBP) plasmids as well as WT-HDAC6 and HDAC6-H803A enzyme-inactive mutant expression plasmids were kindly provided by Dr. Tso-Pang Yao (Duke University). Plasmids were transfected into QBI-293 cells (MP Biomedicals) using Fugene 6 (Roche) per manufacturers instructions. HDAC6 siRNA (Invitrogen) sequence was as follows: AAAGUUGGAACUCUCACGGUGCAGC and was transfected using RNAi Max reagent (Invitrogen) following manufacturer protocols. For oxidative stress treatments, confluent QBI-293 cells grown in 6-well or 10cm dishes were exposed to 50 µM sodium arsenite or 1 mM hydrogen peroxide for 1-12 hr, as indicated in text. Cells were harvested and analyzed by western blotting using the indicated antibodies, as detailed below. Mouse Neuro2A neuroblastoma cells (ATCC) were transfected using Fugene 6 with ΔNLS, ΔNLS-K145Q and ΔNLS-2KQ plasmids and differentiated by 24 hr withdrawal of fetal bovine serum (FBS), which promotes extension of neuritic processes, followed by subsequent western blotting and immunofluorescence studies.
Cohen T.J., Hwang A.W., Restrepo C.R., Yuan C.X., Trojanowski J.Q, & Lee V.M. (2015). An acetylation switch controls TDP-43 function and aggregation propensity. Nature communications, 6, 5845.
+ Open protocol
+ Expand
5

HDAC6 siRNA Transfection and Isoflurane Treatment

Check if the same lab product or an alternative is used in the 5 most similar protocols
HDAC6 and scramble siRNAs were purchased from Qiagen (Germany). The HDAC6 siRNA sequences were as follows: 5′-CUUCGAAGCGAAAUAUUAATT-3′. siRNA transfection reactions were performed using Lipofectamine RNAi Max (Invitrogen, USA) in accordance with the manufacturers' instructions. Twenty-four hours after transfection, the cells were treated with isoflurane and measured by proliferation assay and Western blot analysis at 24 h post-gas exposure.
Zhang W., Xue F., Xie S., Chen C., Li J, & Zhu X. (2020). Isoflurane promotes proliferation of squamous cervical cancer cells through mTOR-histone deacetylase 6 pathway. Molecular and Cellular Biochemistry, 476(1), 45-55.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!