Lightcycler 96 system

Manufactured by Roche

Sourced in Switzerland, Germany, United States, China, Japan, United Kingdom, Denmark, Estonia, Canada, Sweden

The LightCycler 96 System is a qPCR instrument designed for real-time PCR analysis. It enables quantitative detection and analysis of nucleic acid sequences. The system provides precise temperature control and rapid thermal cycling to facilitate efficient amplification and detection of target sequences.

Automatically generated - may contain errors

Lab products found in correlation

Trizol reagent, by Thermo Fisher Scientific (212 mentions) Rneasy mini kit, by Qiagen (83 mentions) Primescript rt reagent kit, by Takara Bio (81 mentions) Faststart essential dna green master, by Roche (75 mentions) Trizol, by Thermo Fisher Scientific (60 mentions) Primescript rt master mix, by Takara Bio (42 mentions) Primescript rt reagent kit with gdna eraser, by Takara Bio (39 mentions) Revertaid first strand cdna synthesis kit, by Thermo Fisher Scientific (36 mentions) Tb green premix ex taq 2, by Takara Bio (30 mentions) High capacity cdna reverse transcription kit, by Thermo Fisher Scientific (27 mentions) Thunderbird sybr qpcr mix, by Toyobo (26 mentions) Lightcycler 96, by Roche (24 mentions) Sybr premix ex taq, by Takara Bio (24 mentions) Sybr premix ex taq 2, by Takara Bio (24 mentions) Transcriptor first strand cdna synthesis kit, by Roche (24 mentions) Nanodrop, by Thermo Fisher Scientific (19 mentions) Revertra ace qpcr rt master mix, by Toyobo (19 mentions) Nanodrop 2000 spectrophotometer, by Thermo Fisher Scientific (18 mentions) Revertra ace qpcr rt kit, by Toyobo (18 mentions) Taqman gene expression assay, by Thermo Fisher Scientific (17 mentions)

Spelling variants of this product

LightCycler 96 (2296 citations) LightCycler (1119 citations) LightCycler 96 Real-Time PCR System (660 citations) LightCycler system (466 citations) LightCycler 96 qPCR system (21 citations) LightCycler 96 Real-time Quantitative PCR Detection System (8 citations) LightCycler 96 quantitative PCR system (4 citations) LightCycler® 96 instrument qRT-PCR system (4 citations) Roche Applied Science LightCycler® 96 Real-Time PCR System (2 citations) LightCycler 480 system with a 96-well format (2 citations)

1 391 protocols using lightcycler 96 system

mCherry-irg1l Fusion Protein Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

qRT-PCR for RNA-seq verification was performed using 10 ng of total RNA in a one-step qRT-PCR [Luna Universal One-Step RT-qPCR Kit, New England Biolabs (NEB)] and performed on a Roche LightCycler 96 system. Primers were designed for verifying some of the up-regulated and immune-related genes (see table S1 for primers used). All graphs are representative of two independent experiments with three technical replicates.
Functional testing of mCherry-irg1l fusion protein was performed by RNA overexpression, followed by qRT-PCR assays of mmp9 target gene induction (22 (link)). Briefly, untagged irg1l and mCherry-irg1l were subcloned into pCS2⁺ vectors and used as templates for in vitro transcription. Equimolar amounts of each RNA were injected into one-cell–staged embryos, and total RNA was extracted from 50 embryos at 28 hpf using TRIzol reagent (catalog no. 15596026, Invitrogen) following the manufacturer’s recommendations. Total RNA (100 ng) was used in a one-step qRT-PCR (Luna Universal One-Step RT-qPCR Kit, NEB) and performed on a Roche LightCycler 96 system. All analyses were carried out in triplicate. Results are representative of two independent experiments with three technical replicates each. See table S1 for primer sequences.

Van Gennip J.L., Boswell C.W, & Ciruna B. (2018). Neuroinflammatory signals drive spinal curve formation in zebrafish models of idiopathic scoliosis. Science Advances, 4(12), eaav1781.

+ Open protocol

+ Expand

Quantification of Muscle Regulatory Genes

Check if the same lab product or an alternative is used in the 5 most similar protocols

Breast muscle samples (approximately 1 cm³) were collected from the same location, frozen in liquid nitrogen, and stored at −80°C for analysis. mRNA levels of IGF-1, MyoD, and MSTN in the breast muscles were examined. Total RNA was extracted from each breast muscle sample using TRIzol reagent (Invitrogen, Carlsbad, CA) according to the manufacturer's instructions. RT-PCR was performed using a LightCycler 96 system (LightCycler 96 system, Roche, Basel, Switzerland) based on the general RT-PCR method. The primers for the target genes were designed and confirmed (Table 1). β-Actin was used as the reference gene. The gene expression data were expressed as relative quantification and calculated using the 2-^ΔΔCt method.Table 1

Primers used for quantitative RT-PCR.

Primer name1	Primer sequence2 5'-3'	Product size (bp)	GenBank accession number
β-actin	F: TGCTGTGTTCCCATCTATCG	150	NM_205518
	R: TTGGTGACAATACCGTGTTCA
IGF-1	F: ACCTTGGCCTGTGTTTGCTTAC	111	NM_001004384
	R: AGCCTCTGTCTCCACATACGAAC
MSTN	F: TACCCGCTGACAGTGGATTTC	153	NM_001001461
	R: GCCTCTGGGATTTGCTTGG
MyoD	F:GGAGAGGATTTCCACAGACAACTC	113	NM_204214
	R: CTCCACTGTCACTCAGGTTTCCT

β-actin, beta-actin; IGF-1, insulin-like growth factor-1; MSTN, myostatin; MyoD myogenic determination factor 1.

F, forward; R, reverse.

Li X.M., Zhang M.H., Liu S.M., Feng J.H., Ma D.D., Liu Q.X., Zhou Y., Wang X.J, & Xing S. (2019). Effects of stocking density on growth performance, growth regulatory factors, and endocrine hormones in broilers under appropriate environments. Poultry Science, 98(12), 6611-6617.

+ Open protocol

+ Expand

Genotyping of Immunological Genes

Check if the same lab product or an alternative is used in the 5 most similar protocols

DNA was extracted from EDTA blood, using a genomic DNA isolation kit (Genet bio, Korea) based on the manufacturer's instructions. Purity and DNA quantification were recognized by ultraviolet spectrophotometry (Infinite 200 PRO NanoQuant, Tecan).
We genotyped single-nucleotide polymorphisms (SNPs) of three genes: IL-10, TNFα, and ANXA5 using real-time polymerase chain reaction (PCR) and high-resolution melting (HRM) assay (Light Cycler 96 System, Roche, Germany). We used “no template” controls to evaluate the contamination. The condition for real-time PCR and HRM was as follows: preincubation 1 Cycles: 95°C for 900 s; 3 Step amplification, 45 Cycles: 95°C for 15 s, 60°C for 20 s, 72°C for 20 s; HRM, 1 Cycles: 95°C for 60 s, 40°C for 60 s, 65°C for 1 s, 97°C for 1 s continuous; cooling, 1 Cycles: 40°C for 10 s.
We confirmed genotyping by sequencing of 10% of the templates. Data were analyzed using Light Cycler 96 System, Roche, Germany, Application Software.

Hashemi S.M., Baktashian M., Moghaddam K.H., Salehi M., Soflaei S.S., Ferns G., Pasdar A, & Mobarhan M.G. (2019). The association between genetic polymorphisms of the interleukin-10, tumor necrosis factor-alpha, and annexin A5 gene loci and restenosis after percutaneous coronary angioplasty and stenting. Journal of Research in Medical Sciences : The Official Journal of Isfahan University of Medical Sciences, 24, 68.

+ Open protocol

+ Expand

Extraction and Quantification of Serum miRNA

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA of tissues was extracted using a solution of Kiazol (Life Sciences, Iran) and according to the factory method. Total RNA of serum samples from the two healthy and cancerous groups containing microRNAs was prepared by a slightly modified Kiazol solution and using 400 µl serum. The obtained sediment stored in -80 °C freezer. To determine the quantity and purity of the RNA samples a NanoDrop spectrophotometer (Thermo Fisher Scientific, USA) was used, and the binding pattern of samples, on 1% agarose gel was used to test the RNA integrity.
Synthesis of hsa-miR-361-5p specific cDNA was performed using the PASRSGENOME miR Amp kit and following the manufacturer's instructions.
The Real-Time PCR technique was performed using Real Q Plus 2x Master Mix Green (AMPLICON, Denmark) kits and LightCycler®96 System (Roche Life Science, Deutschland GmbH Sandhofer, Germany). Pre-designed specific primers of hsa-miR-361-5p and hsa-miR-16, as an internal standard control for serum and tissue [14, (link)15] (link), were purchased from Exir gene company. The qReal-Time PCR technique was carried out using Real Q Plus 2x Master Mix Green (AMPLICON, Denmark) kits and LightCycler®96 System (Roche Life Science, Deutschland GmbH Sandhofer, Germany). The amplification protocol comprised of one cycle at 95 °C for 5 min followed by 40 cycles at 95 °C for 5 s, 62 °C for 20 s, and then 72 °C for 30 s.

Pishbin F., Ziamajidi N., Abbasalipourkabir R., Najafi R, & Farhadian M. (2023). Correlation of Wilms' Tumor 1 (WT1) with Oxidative Stress Markers and Expression of miR-361-5p; New Aspect of WT1 in Breast Cancer. Indian journal of clinical biochemistry : IJCB, 38(3).

+ Open protocol

+ Expand

Quantification of miRNA, lncRNA, and mRNA

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted from the cultured cells and tissues using Trizol Reagent (Invitrogen, CA, USA) according to the manufacturer’s instruction. For the quantification of miRNA, 0.2 μg of total RNA obtained from cultured cells or tissues was reverse-transcribed to cDNA using AMV reverse transcriptase (TaKaRa, Dalian, China), the real-time PCR analyses were performed using SYBR Green dye(Invitrogen) with LightCycler96 System (Roche, IN, USA). For the quantification of lncRNA and mRNA, 1 μg of total RNA was reverse-transcribed to cDNA using Oligo d(T) primer (TaKaRa, Dalian, China), the real-time PCR analyses were performed using SYBR Green dye(Invitrogen) with LightCycler96 System (Roche, IN, USA). All reactions were run in triplicate. After the reactions were complete, the cycle threshold (CT) values were determined with the LightCycler96 software. A comparative CT method was used to compare each condition to the control reactions. In miRNA RT-PCR reaction, U6 was used as an internal control; in lncRNA RT-PCR reaction, GAPDH was used as an internal control, and the relative level was calculated with the eq. 2^−ΔΔCT. The sequences of the primers used in the present study are listed in Table S4.

Wang Z., Wei Y., Zhu H., Yu L., Zhu J., Han Q., Liu Z., Huang J., Zhu Y., Fan G., Tang Q., Qian J., Chen X, & Zhou G. (2022). LncRNA NDRG1 aggravates osteosarcoma progression and regulates the PI3K/AKT pathway by sponging miR-96-5p. BMC Cancer, 22, 728.

+ Open protocol

+ Expand

Quantifying Wolbachia Density in Mosquitoes

Check if the same lab product or an alternative is used in the 5 most similar protocols

To estimate Wolbachia density across multiple mosquito species, RNA extracts were added to Qubit^TM RNA High-Sensitivity Assays (Invitrogen) and total RNA measured using a Qubit 4 Fluorometer (Invitrogen). All RNA extracts were then diluted to produce extracts that were 2.0 ng μl⁻¹ prior to being used in quantitative reverse-transcription PCR (qRT-PCR) assays targeting the Wolbachia 16S rRNA gene [28 (link)]. A synthetic oligonucleotide standard (Integrated DNA Technologies) was designed to calculate 16S rRNA gene copies per µl using a 10-fold serial dilution (electronic supplementary material, figure S1). 16S rRNA gene real-time qRT-PCR reactions were prepared using 5 µl of QuantiNova SYBR^® Green RT-PCR Kit (Qiagen), a final concentration of 1 µM of each primer, 1 µl of PCR grade water and 2 µl template RNA, to a final reaction volume of 10 µl. Prepared reactions were run on a Roche LightCycler^® 96 System for 15 min at 95°C, followed by 40 cycles of 95°C for 15 s and 58°C for 30 s. Amplification was followed by a dissociation curve (95°C for 10 s, 65°C for 60 s and 97°C for 1 s) to ensure the correct target sequence was being amplified. Each mosquito RNA extract was run in triplicate alongside standard curves and no template controls (NTCs) and PCR results were analysed using the LightCycler^® 96 software (Roche Diagnostics).

Jeffries C.L., Cansado-Utrilla C., Beavogui A.H., Stica C., Lama E.K., Kristan M., Irish S.R, & Walker T. (2021). Evidence for natural hybridization and novel Wolbachia strain superinfections in the Anopheles gambiae complex from Guinea. Royal Society Open Science, 8(4), 202032.

+ Open protocol

+ Expand

Transcriptome Analysis of SbWRKYs

Check if the same lab product or an alternative is used in the 5 most similar protocols

Four different tissues (roots, stems, leaves, and flowers) of S. baicalensis were collected during the flowering period for transcriptome sequencing, and the tissue-specific expression patterns of SbWRKYs were further detected. The method used to calculate the transcript abundance of SbWRKYs was through its estimation according to the number of fragments per base in the exon model (FPKM) per million mapped reads. Real-time fluorescent quantitative PCR (qPCR) used a Roche LightCycler 96 system (Roche Diagnostics GmbH, Basel, Switzerland) with ChamQTM SYBR^® qPCR Master Mix (Roche), where the PCR reaction conditions were 95 °C for 30 s, 95 °C for 5 s, and 60 °C for 30 s, for a total of 45 cycles. Each reaction had three biological and technical replicates, using 20-fold diluted cDNA as a template. The 2^−∆∆CT method was employed to calculate the corresponding expression of SbWRKYs.

Zhang C., Wang W., Wang D., Hu S., Zhang Q., Wang Z, & Cui L. (2022). Genome-Wide Identification and Characterization of the WRKY Gene Family in Scutellaria baicalensis Georgi under Diverse Abiotic Stress. International Journal of Molecular Sciences, 23(8), 4225.

+ Open protocol

+ Expand

Quantification of Viral Gene Expression

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total cellular RNA was extracted from the MDV-infected, REV-infected, MDV/REV coinfected, and mock-infected CEF cells using RNAiso Plus (TaKaRa, Dalian, China) following the manufacturer's instructions. cDNA was prepared from the RNA using ReverTra Ace qPCR RT Master Mix (TOYOBO, Shanghai, China) and used as a template for quantitative reverse transcription PCR (qRT-qPCR). Whereafter qRT-PCR was performed using the SYBR Premix Ex Taq™ II Kit (TaKaRa) on a Roche LightCycler 96 system (Roche, Basel, Switzerland). Real-time quantitative PCR (qPCR) detection was performed as previously described (20 (link)). Specific primers for amplifying various genes were as follows: for GAPDH mRNA analysis, 5′-GAACATCATCCCAGCGTCCA-3′ (forward) and 5′-GGTCATAAGTCCCTCCACGA-3′ (reverse) were used; for REV gp90 analysis, 5′-GGCATCAATCGTACCCGACA-3′ (forward) and 5′-GGGGGATAAACTGGACTGCC-3′ (reverse) were used; for MDV pp38 analysis, 5′-GCTGCAGCTGTCCATTTTCC-3′ (forward) and 5′-TACAGTGTAGCCGTACCCGA-3′ (reverse) were used. GAPDH was employed as an internal reference gene. The relative expression level of each mRNA was calculated by the 2^−ΔΔct method. Three independent biological replicates were performed for each gene.

Du X., Zhou D., Zhou J., Xue J, & Cheng Z. (2022). Marek's Disease Virus and Reticuloendotheliosis Virus Coinfection Enhances Viral Replication and Alters Cellular Protein Profiles. Frontiers in Veterinary Science, 9, 854007.

+ Open protocol

+ Expand

cDNA Synthesis and qPCR Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

cDNA was synthesized according to the instructions of EasyScript One-Step gDNA removal and cDNA synthesis SuperMix (Transgen Biotechnology, Beijing, China). qPCR was performed using TaKaRa SYBR Premix Ex Taq™ II (TaKaRa Biotechnology, Dalian, China) on the Roche Light Cycler 96 System (Roche, Swiss). The PCR procedures were as follows: 95 °C for 5 min; 45 cycles of 95 °C for 10 s, 60 °C for 10 s, and 72 °C for 15 s; the melting curve analysis was from 65 °C to 95 °C. The information of the primers was listed as Additional file 2: Table S1.

Ni J., Shah F.A., Liu W., Wang Q., Wang D., Zhao W., Lu W., Huang S., Fu S, & Wu L. (2018). Comparative transcriptome analysis reveals the regulatory networks of cytokinin in promoting the floral feminization in the oil plant Sapium sebiferum. BMC Plant Biology, 18, 96.

+ Open protocol

+ Expand

RNA Expression Quantification from Tissues

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA extraction from tissues was performed using Trizol (Invitrogen), followed by reverse transcription using a Reverse Transcription System (Promega). The resulting cDNA was combined with SYBR Green PCR Kit (Roche) and specific primers to initiate real-time qPCR using the Roche Light Cycler 96 System (Roche, USA). The relative mRNA expression levels were determined using the 2^-ΔΔCt method and normalized to β-actin (FBXO43, forward primer: 5'-GGAAAGTAAGCAGAAATTGGCGTG-3', reverse primer: 5'-GAGTGGCAGCATCCTCGACATT-3'; β-actin, forward primer: 5'-GACGATATCGCTGCGCTGG-3', reverse primer: 5'-CCACGATGGAGGGGAATA-3').

Liu J., Yang X., Li M., Liu Y.Y., Wang Y., Li S, & Zheng F. (2023). High Expression of F-Box Protein 43 Is Associated With Poor Prognosis and Adjuvant Chemotherapy Resistance in Colorectal Cancer. World Journal of Oncology, 14(4), 246-254.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!