Hybond n

All the bacterial strains used in this study were previously reported [1 (link)]. Briefly, the isolates were collected from a four-state integrated surveillance system for Salmonella in Mexico [10 (link)]. The geographic locations of these states range from the Northwestern (Sonora) to the Southeastern (Yucatán) part of Mexico, located about 2,000 km apart, and the Central states of Michoacán and San Luis Potosí (about 450 km far apart). For genome sequencing and PCR procedures, DNA was extracted from liquid cultures by a modification of the salt extraction method [11 (link)] described in [12 (link)]. To analyze the plasmid content for selected isolates, a modified protocol of the alkaline lysis procedure [13 (link)] was used as described previously [12 (link)]. The products were separated in 0.7% agarose gels in 1X TBE buffer at 100 volts for 5 hours, stained in 1% ethidium bromide and photographed. The plasmid profile gels were transferred to positively charged membranes (Amersham Hybond^TM -N⁺) and hybridized with ³²P-radioactively-labelled probes by standard methods [14 ]. Hybridizations were carried out at 65°C.

A total of 1 μg of genomic DNA from MU402 and the mutants of M. circinelloides were digested with indicated restriction enzyme. DNA was electrophorized and transferred to nylon membranes (HybondTM-N+, Amersham Biosciences, UK) following the recommended protocol [51 ]. Southern blot hybridization was performed under stringent conditions. DNA probes were labelled with [α-32P] dCTP using Ready-To-Go Labeling Beads (GE Healthcare Life Science). For Southern blot experiments, a DNA probe (1 kb) was directly amplified from genomic DNA from M. circinelloides using the primer pairs that amplified the 5′ region upstream of the start translation codon from gpa11, for gpa12 identification a fragment (1 kb) corresponding to the 3′ region downstream from the stop translation codon was used as a probe and finally the primer pairs that amplified the 3′ region downstream from the stop translation codon (1 kb) from gpa11 for the double mutation.

Southern blotting to find the number of ChloroIBP genes in the gene family was performed as previously described [58 (link)]. Genomic DNA (10 μg) extracted using the method of Fulton et al. [77 ] was digested with restriction endonucleases (BamHI, KpnI, and XbaI) and then separated on a 0.7% agarose gel. DNA fragments separated by electrophoresis were transferred to a nylon membrane (HybondTM-N+, Amersham). ChloroIBP DNA labeled by incorporation with α³²P-dCTP (Table 1) was used as a probe following hybridization protocols used for northern blot analysis (Stratagene, USA).

PVS3‐derived siRNA was confirmed as described previously (Sunkar et al., 2005). Total RNA (10 µg per lane) was resolved on a denaturing 15% polyacrylamide gel and transferred electrophoretically to Hybond^TM‐N⁺ (Amersham, Piscataway, NJ, USA) membranes. The membranes were ultraviolet (UV) cross‐linked and baked for 1 h at 80 °C. The cDNA probe was labelled with ³²P‐dCTP using a random‐primed DNA labelling kit (Takara, Kusatsu, Japan). The probe was a 488 bp sense‐fragment of PVS3 cDNA, which was amplified using primers sense‐PVS3‐ClaI‐F (5′‐CCATCGATAAGCTTCACATGTAAGGACTCA‐3′) and sense‐PVS3‐BamHI‐R (5′‐CGGGATCCGACCTCAAGTTCTTTTACTATT‐3′) (restriction sites are underlined). Blots were pre‐hybridized for at least 10 min, then hybridized overnight using PerfectHYB Plus buffer (Sigma, St. Louis, MO, USA) at 30 °C. The blots were washed four times with 4 × SSC (SSC: 0.15 M NaCl and 0.015 M sodium citrate) and 0.1% v/v sodium dodecyl sulphate (SDS) for 5 min at 40 °C.

For identification of T-DNA copy number in transgenic plants developed using both the binary vectors, 10 µg of genomic DNA from transgenic and wild-type plants was digested with HindIII (NEB high fidelity, New England Biolabs, Ipswich, Massachusetts, USA) overnight and separated on 0.8% agarose gel in 1X TAE buffer at constant voltage of 40 V. Restricted fragments were transferred onto a positively charged nylon membrane (Amersham™ Hybond™-N⁺) by capillary movement using 20× SSC and the membrane was later UV cross-linked. The membrane was hybridized with a DIG labeled 571 bp GFP and 750 bp nptII gene fragment for their corresponding transgenic plants. The blot was further processed with washing, blocking, and development as per manufacturer’s instructions (Roche Holding AG, Basel, Switzerland). The membranes were exposed to X-ray film for 1 h in dark and later observed for hybridization signal.

Total nucleic acids were extracted from infected protoplasts, separated by agarose gel electrophoresis, and transferred to nylon membrane (Hybond-N⁺, Amersham), after ensuring even loading via monitoring rRNA levels. Coding sense PEMV1 genome and sg mRNA were detected by blotting with nine oligonucleotide probes 5′-end-labeled with [γ -³²P] complementary to both the genome and sg mRNA (genome coordinates: 4004–4031, 4324–4359, 4401–4434, 4681–4708, 4749–4780, 4936–4968, 5122–5389, 5406–5439, 5679–5703). Northern blots, from three independent repeats, were captured using Typhoon FLA 9500 Variable Mode Imager and viral RNA bands were quantified using QuantityOne software. Sg mRNA levels of each mutant PEMV1 were calculated to generate average values with SE.