Ibright fl1000

Manufactured by Thermo Fisher Scientific

Sourced in United States

The iBright FL1000 is a compact and versatile fluorescence imaging system designed for life science research applications. It provides high-resolution imaging and analysis capabilities for a wide range of fluorescent samples, including gels, blots, and microplates. The system utilizes a high-sensitivity CCD camera and specialized optics to capture detailed images with excellent signal-to-noise ratio. The iBright FL1000 is a versatile tool for researchers in various fields, enabling reliable and efficient visualization and quantification of fluorescent signals.

Automatically generated - may contain errors

Lab products found in correlation

Ne per nuclear and cytoplasmic extraction reagent, by Thermo Fisher Scientific (6 mentions) β actin, by Cell Signaling Technology (4 mentions) Lamin b2, by Cell Signaling Technology (4 mentions) Western ecl substrate mixture, by Bio-Rad (4 mentions) Nitrocellulose membrane, by Bio-Rad (4 mentions) Gapdh, by Santa Cruz Biotechnology (3 mentions) Cleaved caspase 1, by Cell Signaling Technology (3 mentions) β actin, by Thermo Fisher Scientific (3 mentions) Nlrp3, by Abcam (3 mentions) Supersignal west pico plus, by Thermo Fisher Scientific (3 mentions) Pvdf membrane, by Thermo Fisher Scientific (3 mentions) Human map kinase phosphorylation antibody array kit, by Abcam (2 mentions) Human growth factor antibody array kit, by Abcam (2 mentions) Supersignal west dura substrate, by Thermo Fisher Scientific (2 mentions) Amersham ecl western blotting detection reagent, by GE Healthcare (2 mentions) Gsk 3β 27c10, by Cell Signaling Technology (2 mentions) Phospho gsk 3β ser9, by Cell Signaling Technology (2 mentions) Agarose, by Bio-Rad (2 mentions) Sybr safe dna gel stain, by Thermo Fisher Scientific (2 mentions) Faststart universal sybr green master, by Merck Group (2 mentions)

Close spelling variants of this product

Invitrogen™ iBright™ FL1000 Western Blot Imaging Systems IBright FL1000 image system IBright FL1000 imager IBright FL1000 Instrument Invitrogen iBright FL1000 Imaging System IBright FL1000 Imaging System

88 protocols using ibright fl1000

Phosphorylation Profiling of MAPK Pathways in DPCs

Check if the same lab product or an alternative is used in the 5 most similar protocols

Human MAP Kinase Phosphorylation Antibody Array Kit (Abcam, Cambridge, UK) was used to elucidate the changes in signal transduction pathways in DPCs. A total of 17 human proteins for phosphorylation were analyzed. Cells were treated with 1.5 and 3 mM of adenosine for an appropriate time and then collected for protein phosphorylation analysis. Cells treated with the vehicle medium were used as the non-treated control. The conventional immunoblot process was performed following the manufacturer’s protocol. The resulting blots were analyzed under the same condition using iBright FL1000 (Invitrogen, Waltham, MA, USA).

Kim J., Shin J.Y., Choi Y.H., Kang N.G, & Lee S. (2022). Anti-Hair Loss Effect of Adenosine Is Exerted by cAMP Mediated Wnt/β-Catenin Pathway Stimulation via Modulation of Gsk3β Activity in Cultured Human Dermal Papilla Cells. Molecules, 27(7), 2184.

+ Open protocol

+ Expand

Characterization of TRIM-MDA5 interactions

Check if the same lab product or an alternative is used in the 5 most similar protocols

For experiments requiring dsRNA, 112 bp dsRNA was used unless mentioned otherwise. For detection purpose, either Cy5-labeled dsRNA or fluorescein-labeled protein was used (as mentioned in the relevant experiments). For experiments where Cy5-labeled dsRNA was used, MDA5 (or other RLHs) and/or their variants at 0.25 μM were first incubated with dsRNA (1 ng/μl) for 30 min in 20 mM HEPES pH 7.5, 100 mM NaCl, 1.5 mM MgCl₂ and 2 mM DTT at RT with or without 2 mM ATP. This was followed by the addition of the TRIM proteins (TRIM65, RIPLET, TRIM14, TRIM16, TRIM25 or TRIM47) and/or their variants (as mentioned in the experiment). The mixture was further incubated at RT for 10 min and the samples were then analyzed on Bis-Tris native PAGE (Life Technologies). For experiments where fluorescin-labeled TRIM65 CC-PSpry was used, GST-tagged MDA5 variants (1.6 μM) were directly incubated with fluorescin-labeled TRIM65 CC-PSpry (0.8 μM) for 15 min at RT before analyzing on native PAGE. For experiments where fluorescin-labeled MDA5 was used, fluorescin-labeled MDA5 or its variants (0.6 μM) was incubated with TRIM65 (0.3 μM) in the presence or absence of 112 bp dsRNA (8 ng/μl) for 30 min, and the mixture was analyzed on native PAGE. The gels were imaged using either Cy5 or fluorescin fluorescence in iBright FL1000 (Invitrogen).

Kato K., Ahmad S., Zhu Z., Young J.M., Mu X., Park S., Malik H.S, & Hur S. (2020). Structural analysis of RIG-I-like receptors reveals ancient rules of engagement between diverse RNA helicases and TRIM ubiquitin ligases. Molecular cell, 81(3), 599-613.e8.

+ Open protocol

+ Expand

Western Blot Analysis of SAN Proteins

Check if the same lab product or an alternative is used in the 5 most similar protocols

SAN dissected from sham and TAC mice were lysed by Bertin homogenizer with radioimmunoprecipitation assay lysis buffer, run on 4–20% or 3–8% discontinuous gradient polyacrylamide gels depending on the molecular weight of the proteins, and transferred to nitrocellulose membranes. Nitrocellulose membranes were incubated with blocking buffer of TBS with Tween-20 (TBST; 1%) and BSA (3%). Membranes were then incubated with primary antibodies (listed in Table S1) diluted in 3% BSA TBST overnight at 4°C, followed by the secondary antibodies. Antigen complexes were visualized with iBright FL1000 (Invitrogen by Thermo Fisher Scientific) and quantified with ImageJ (National Institutes of Health).

Xue J.B., Val-Blasco A., Davoodi M., Gómez S., Yaniv Y., Benitah J.P, & Gómez A.M. (2022). Heart failure in mice induces a dysfunction of the sinus node associated with reduced CaMKII signaling. The Journal of General Physiology, 154(9), e202112895.

+ Open protocol

+ Expand

Western Blot Analysis of Spinal Cord Proteins

Check if the same lab product or an alternative is used in the 5 most similar protocols

Spinal cords from 12 animals were isolated at the desired time point and manually homogenized in RIPA buffer including protease inhibitor. Extracted proteins were separated by 10% sodium dodecyl sulfate–polyacrylamide gel electrophoresis, and transferred to polyvinylidene difluoride membranes. Primary and secondary antibodies were incubated separately in 3% BSA in TBS-T and revealed with SuperSignal West Pico Chemiluminescent Substrate in the iBright FL-1000 (Invitrogen). Details of antibodies and concentrations used are reported in Table S8. All blots or gels were derived from the same experiment and processed in parallel.

Peñailillo J., Palacios M., Mounieres C., Muñoz R., Slater P.G., De Domenico E., Patrushev I., Gilchrist M, & Larraín J. (2021). Analysis of the early response to spinal cord injury identified a key role for mTORC1 signaling in the activation of neural stem progenitor cells. NPJ Regenerative Medicine, 6, 68.

+ Open protocol

+ Expand

Western Blot Analysis of Protein Extracts

Check if the same lab product or an alternative is used in the 5 most similar protocols

Frozen tissue samples were homogenized (Bertin Precellys 24) in ice cold buffer containing HEPES 50 mM, KCl 50 mM, ethylenediaminetetraacetic acid (EDTA) 1 mM, β-glycerophosphate 5 mM, Triton X-100 0.1%, orthovanadate 1 mM, dithithreitol 1 mM, sodium fluoride 50 mM, Na pyrophosphate 5 mM, phenylmethylsulfonyl fluoride 0.2 mM, and antiprotease cocktail set (Calbiochem 539134). Protein extracts were separated on SDS-polyacrylamide gel (8% to 12%) and then transferred to polyvinylidene difluoride membranes for Western blot. After 1 hour of blocking in PBS containing TWEEN20 (0.1%) and non-fat milk (5%), the membranes were incubated overnight at 4 °C with primary antibody (Table 3). After washing, the membranes were incubated with a secondary antibody coupled with horseradish peroxidase for 1 hour at room temperature and visualized using chemiluminescent substrate (Luminata™ Western Chemiluminescent HRP Substrates, Millipore). Light emission was detected by autoradiography and quantified using an image-analysis system (iBright FL1000, Invitrogen, Waltham, MA, USA).

Sanz M.N., Grimbert L., Moulin M., Gressette M., Rucker-Martin C., Lemaire C., Mericskay M., Veksler V., Ventura-Clapier R., Garnier A, & Piquereau J. (2019). Inducible Cardiac-Specific Deletion of Sirt1 in Male Mice Reveals Progressive Cardiac Dysfunction and Sensitization of the Heart to Pressure Overload. International Journal of Molecular Sciences, 20(20), 5005.

+ Open protocol

+ Expand

Western Blot Analysis of Signaling Proteins

Check if the same lab product or an alternative is used in the 5 most similar protocols

Cells were washed with PBS and lysed with RIPA Buffer (Sigma-Aldrich; Merck KGaA). Protein concentration of the cell lysates was calculated by DC Protein assay (Bio-Rad Laboratories Inc.) according to the manufacturer's instructions, and each probe was diluted to samples of 10 µg of protein. Samples were mixed with 3.75 µl loading dye and separated by SDS-page. The separated proteins were transferred to a polyvinylidene fluoride membrane and then blocked with a TBST buffer and 5% non-fat dry milk. Incubation with primary antibodies took place overnight. The primary antibodies used were EGFR, pEGFR, HER3, pHER3, AKT, pAKT, ERK, pERK and GAPDH. After three washing steps with the TBST buffer, the membrane was incubated with a secondary antibody followed by three additional washing steps. For luminescence detection, the membrane was coated with 1 ml luminol and 1 ml peroxide solution and then analysed with an IBright FL 1000 (Invitrogen; Thermo Fisher Scientific, Inc.).

Heid J., Affolter A., Jakob Y., Kern J., Rotter N., Tenschert E, & Lammert A. (2022). 3D cell culture alters signal transduction and drug response in head and neck squamous cell carcinoma. Oncology Letters, 23(6), 177.

+ Open protocol

+ Expand

Profiling Growth Factor and RTK Signaling

Check if the same lab product or an alternative is used in the 5 most similar protocols

Human growth factor antibody array kit (Abcam, Cambridge, UK) and human receptor tyrosine kinase (RTK) phosphorylation antibody array kit (Abcam, Cambridge, UK) were used to elucidate the changes in growth factor profiles and signal transduction pathways in DPCs. Total of 41 human growth factors and 71 human RTK phosphorylation were analyzed. Cells were treated with 100 nM and 1 µM of quercitrin for appropriate time and then collected for growth factor and RTK phosphorylation analysis. Cells treated with vehicle medium were used as non-treated control. Conventional immunoblot process was performed following the manufacturer’s protocol. The resulting blots were analyzed under identical condition using iBright FL1000 (Invitrogen, Waltham, MA, USA).

Kim J., Kim S.R., Choi Y.H., Shin J.Y., Kim C.D., Kang N.G., Park B.C, & Lee S. (2020). Quercitrin Stimulates Hair Growth with Enhanced Expression of Growth Factors via Activation of MAPK/CREB Signaling Pathway. Molecules, 25(17), 4004.

+ Open protocol

+ Expand

Genetic Profiling of Vasculitis Patients

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

All included patients had available DNA samples. Affymetrix Axiom Biobank Genotyping Array was used for genotyping 286 patients as part of the Vasculitis Clinical Research Consortium GWAS (2 (link)). An additional 115 patients and 130 healthy controls were genotyped by PCR (including confirmation of 15 of the GWAS patients), via amplification of the SNP-containing region using forward primer 5′ GAGCTGACTCATGGCTGAAACCAAC 3′, reverse primer 5′ TGATGTGTATTAAAGAACTAGAGCT 3′. PCR products were separated by agarose gel electrophoresis and imaged using iBright FL1000 (Invitrogen, Thermo Fisher Scientific) (Supplemental Figure 1).

Chen D.P., Aiello C.P., McCoy D., Stamey T., Yang J., Hogan S.L., Hu Y., Derebail V.K., Wu E.Y., Jennette J.C., Falk R.J, & Ciavatta D.J. (2023). PRTN3 variant correlates with increased autoantigen levels and relapse risk in PR3-ANCA versus MPO-ANCA disease. JCI Insight, 8(4), e166107.

+ Open protocol

+ Expand

Western Blot Analysis of Cellular Proteins

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Cells (0.4–0.6 × 10⁶) were lysed in 25 μl SDS lysis buffer, and cell lysates were resolved by 10% SDS–polyacrylamide gel electrophoresis followed by Western blot analysis as described earlier (Saini et al, 2022 (link)). Primary antibodies were used at the following dilution: Notch1 (1:500), SLC43A2 (1:500), SLC7A5 (1:500), actin (1:1,000), HES1 (1:500), and tubulin (1:1,000) diluted in 5% skimmed milk in Tris-buffered saline–Tween 20 (TBST). Horseradish peroxidase–conjugated secondary antibody was used at a 1:1,000 dilution. The membranes were developed using Super Signal West Dura substrate (Thermo Fisher Scientific), and images were acquired in iBright FL1000 (Invitrogen).

Saini N., Naaz A., Metur S.P., Gahlot P., Walvekar A., Dutta A., Davathamizhan U., Sarin A, & Laxman S. (2022). Methionine uptake via the SLC43A2 transporter is essential for regulatory T-cell survival. Life Science Alliance, 5(12), e202201663.

+ Open protocol

+ Expand

FoxP3 Variants DNA Binding Assay

Check if the same lab product or an alternative is used in the 5 most similar protocols

0.2 μM of DNA was mixed with the indicated amount of FoxP3 variants or other FoxP proteins in the buffer (20 mM Tris-Hcl pH 7.5, 150 mM NaCl, 1.5 mM MgCl₂, and 2 mM DTT). Proteins and DNAs were incubated for 30 min at 4 °C and analyzed on 3–12% gradient Bis-Tris native gels (Life Technologies) at 4 °C. After staining with Sybr Gold stain (Life Technologies), Sybr Gold fluorescence was recorded using iBright FL1000 (Invitrogen) and analyzed with iBright Analysis Software.

Leng F., Zhang W., Ramirez R.N., Leon J., Zhong Y., Hou L., Yuki K., van der Veeken J., Rudensky A.Y., Benoist C, & Hur S. (2022). The transcription factor FoxP3 can fold into two dimerization states with divergent implications for regulatory T cell function and immune homeostasis. Immunity, 55(8), 1354-1369.e8.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!