Abi prism 7700

BM-derived neutrophils were stimulated with LPS (100 ng/ml) for 4 hours at 37°C, and IL-1β, KC, TNF-α, and MIP-2 expression levels were determined by quantitative PCR using SYBR universal PCR master mix and the ABI PRISM 7700 sequence detection system (Thermo Fisher Scientific) and analyzed as described in online supplement. Expression levels were analyzed using the cycle threshold (ΔΔCt) method and normalized to peptidylprolyl isomerase A (pPia) expression. A taqman AOD primer was used for pPia (Invitrogen). LPS-stimulated neutrophil cytokine expression levels were reported as the fold change over unstimulated neutrophil expression levels. The following primer sequences were used for IL-1β: GCCCATCCTCTGTGACTCAT and AGGCCACAGGTATTTTGTCG; for KC: GCTGGGATTCACCTCAAGAA and TGGGGACACCTTTTAGCATC; for TNF-α: GAACTGGCAGAAGAGGCACT and AGGGTCTGGGCCATAGAACT; and for MIP-2: AGTGAACTGCGCTGTCAATG and TTCAGGGTCAAGGCAAACTT.

Total RNA was isolated from the glomeruli using TRIzol (Life Technologies Japan). Reverse transcriptase reactions were performed using a Ready-To-Go T-Primed First-Strand Kit (GE Healthcare Japan, Tokyo, Japan) for first-strand cDNA synthesis. Real-time quantitative PCR was performed using the ABI Prism 7700 sequence detection system (Life Technologies Japan). Data were expressed as copy number relative to that of 18 S rRNA. Primers and probes for TaqMan analysis of human NOX2, mouse Nox2, mouse Nox4, mouse P22, mouse P47, and mouse P67 are included in Supplementary Table S1. TaqMan probes consist of a fluorophore 6-carboxyfluorescein covalently attached to the 5′ end of the oligonucleotide probe and a quencher tetramethylrhodamine at the 3′ end.

The microdissected tissues were snap frozen on dry ice and stored at -80°C until RNA isolation. RNA was isolated according to the RNeasy Midi manufacturer’s protocol (Qiagen, Valencia, CA). The isolated RNA was then treated with DNase I. Using the ABI PRISM 7700 (Life Technology, Foster City, CA), the relative mRNA expression levels of Crhr2 were determined in the dissected brain regions. Vector NTI (Invitrogen, Carlsbad, CA) was utilized to design primer (LC551 and LC552, Table 1). For the qRT-PCR assay, cDNA was generated from the RNA each sample obtained from iP and iNP rats using 50 ng of total RNA template, 0.2 μM forward and reverse primers, and SYBR Green PCR Master Mix (Life Technology). Amplification was performed in triplicate for 40 cycles in two separate experiments resulting in six values for each sample. The specificity of the PCR product was confirmed using gel electrophoresis.
The relative values of expression were determined using the standard curve method, and normalized to the Ct values of “housekeeping” gene cyclophillin B, (LC555 and LC556, Table 1). No differences were detected in the average cyclophilin B Ct values when comparing iP versus iNP in each respective brain region, indicating that cyclophilin B represents an appropriate control for normalization. Repeated measurement ANOVA was used and statistical significance was set at p<0.05.