Abi 3730 capillary sequencer

Manufactured by Thermo Fisher Scientific

Sourced in United States, Germany, United Kingdom, Switzerland

The ABI 3730 capillary sequencer is a laboratory instrument for DNA sequencing. It utilizes capillary electrophoresis technology to separate and detect fluorescently-labeled DNA fragments. The instrument's core function is to provide automated DNA sequence analysis.

Automatically generated - may contain errors

Lab products found in correlation

Spelling variants of this product

ABI 3730 (234 citations) ABI 3730 sequencer (157 citations) 3730 sequencer (26 citations) 3730 capillary sequencer (17 citations) ABI 3730 Capillary Sequencer with BigDye™ Terminator Cycle Sequencing Ready Reaction kit v.3.1 (2 citations) ABI 3730 Avant capillary sequencer (2 citations)

81 protocols using abi 3730 capillary sequencer

Genotyping NID1 and ENSBTAG00000039845 Variants

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

The associated variants were genotyped by re-sequencing of targeted PCR products using Sanger sequencing technology. PCR primers were designed using PRIMER3 [66] (link). PCR products were run on 0.8% agarose gel, 0.5 µg/ml ethidium bromide. PCR products were amplified using flanking primers (NID1 (F) TCCAAGCGACAAAAGAGGTT, (R) TTTCCGCTCGATACAGTCAA; ENSBTAG00000039845 (F) TGTGGCTCCTAAATGACCAA, (R) ACTTGGAGGATCCCAGGACT; NID1 cDNA (F) TTTCCGCTCGATACAGTCAA, (R) CTTGAAGGGCTGCAGCC with AmpliTaqGold360Mastermix (Life Technologies) and the products directly sequenced using the PCR primers on an ABI 3730 capillary sequencer (Life Technologies) after treatment with exonuclease I (N.E.B) and rAPid alkaline phosphatase (Roche). Sequence data were analyzed using Sequencher 5.1 (GeneCodes). We used an alternative fragment size analysis assay to genotype additional cattle for the NID1 deletion using three primers: (F) CATCAGGGAAATCCTGCTGT and (R_{wild type}) CAGGTGGGTTACCTTCAGGA, and (R_mutant) GTGACCTGGAAAAGGCAGAA. Products were visualized on an ABI 3730 capillary sequencer and analyzed with the GeneMapper 4.0 software (Life Technologies). Fragments with the deletion are 286 bp in length and fragments without the deletion are 176 bp in length.

Murgiano L., Jagannathan V., Calderoni V., Joechler M., Gentile A, & Drögemüller C. (2014). Looking the Cow in the Eye: Deletion in the NID1 Gene Is Associated with Recessive Inherited Cataract in Romagnola Cattle. PLoS ONE, 9(10), e110628.

+ Open protocol

+ Expand

Sanger Sequencing for Targeted Genotyping

Check if the same lab product or an alternative is used in the 5 most similar protocols

Sanger sequencing was used to confirm the Illumina sequencing results and to perform targeted genotyping for 6 variants identified from whole genome sequencing. For these experiments we amplified PCR products using AmpliTaqGold360Mastermix (Life Technologies) and purified PCR products were directly sequenced on an ABI3730 capillary sequencer (Life Technologies). The sequence data were analyzed using Sequencher 5.1 software (GeneCodes).
The GJA9 deletion was genotyped by fragment size analysis (primers: CCTGACAACCACAGTGGAAA (forward) and AGAGCAGTGGTTCCTTTTGC (reverse)) on an ABI3730 capillary sequencer and analyzed with the GeneMapper 4.0 software (Life Technologies).
Comparison of GJA9 allele and genotype frequencies in PN cases and controls was performed in the original GWAS cohort, as well as an independent cohort, by standard chi-square tests.

Becker D., Minor K.M., Letko A., Ekenstedt K.J., Jagannathan V., Leeb T., Shelton G.D., Mickelson J.R, & Drögemüller C. (2017). A GJA9 frameshift variant is associated with polyneuropathy in Leonberger dogs. BMC Genomics, 18, 662.

+ Open protocol

+ Expand

Genotyping of SNPs, InDels, and Duplications

Check if the same lab product or an alternative is used in the 5 most similar protocols

For genotyping of SNPs and small InDels we applied Sanger sequencing. Primers (Table S6) were designed with Primer3 software [41] after masking of repetitive sequences with RepeatMasker [42] . PCR products were amplified using AmpliTaqGold360Mastermix (LifeTechnologies) and directly sequenced on an ABI3730 capillary sequencer (LifeTechnologies) after treatment with exonuclease I and shrimp alkaline phosphatase. The sequence data were analyzed with Sequencher 5.1 software. For genotyping of the 80 kb duplication we set the forward primer at the end of the duplicated sequence and the reverse primer at the beginning of the duplicated sequence (Figure S2), therefore only in the mutant allele a PCR-product was amplified, which was detected on a 1% agarose gel. The polled associated indel detected in Simmental cattle was genotyped using fragment analysis, setting the forward primer at the end of the duplicated sequence and the fluorescently labeled reverse primer in the region afterwards (Figure S1). PCR products were amplified using QIAGEN Multiplex PCR Kit (Qiagen) and the fragment length of the PCR products was directly analyzed with an ABI 3730 capillary sequencer (LifeTechnologies) and the Genemapper-software (LifeTechnologies).

Wiedemar N., Tetens J., Jagannathan V., Menoud A., Neuenschwander S., Bruggmann R., Thaller G, & Drögemüller C. (2014). Independent Polled Mutations Leading to Complex Gene Expression Differences in Cattle. PLoS ONE, 9(3), e93435.

+ Open protocol

+ Expand

Amplifying PRKD Kinase Domains

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

We employed primer sets that amplify the entire kinase domains of PRKD1, PRKD2 and PRKD3. The primers pairs were designed as previously described^{10 (link)} (Supplementary Figure 1 and Supplementary Table 1) and the specificity was also tested using in a previously described in silico method^{19 (link)} (https://genome.ucsc.edu/cgi-bin/hgPcr). PCR amplification of 10ng of genomic DNA was performed using the AmpliTaq 360 Master Mix Kit (Life Technologies, Norwalk, CT) on a Veriti Thermal Cycler (Life Technologies). The thermocycling protocol consisted of an initial incubation step of 95°C for 5 min and then 35 cycles of 95°C for 30 sec, 56°C for 30 sec, 72°C for 30 sec, and one final extension step of 72°C for 10 min. PCR fragments were purified with ExoSAP-IT (Affymetrix, Santa Clara, CA), and the sequencing reactions were performed on an ABI 3730 capillary sequencer using ABI BigDye Terminator chemistry (v3.1, Life Technologies) according to the manufacturer’s instructions. Sequences of the forward and reverse strands were analyzed using MacVector software (MacVector, Inc, Cary, NC).^{10 (link)} All analyses were performed in duplicate.

Piscuoglio S., Fusco N., Ng C.K., Martelotto L.G., da Cruz Paula A., Katabi N., Rubin B.P., Skálová A., Weinreb I., Weigelt B, & Reis-Filho J.S. (2016). Lack of PRKD2 and PRKD3 kinase domain somatic mutations in PRKD1 wild-type classic polymorphous low-grade adenocarcinomas of the salivary gland. Histopathology, 68(7), 1055-1062.

+ Open protocol

+ Expand

Sanger Sequencing of Targeted Variants

Check if the same lab product or an alternative is used in the 5 most similar protocols

The associated variant was genotyped by re-sequencing of targeted PCR products using Sanger sequencing technology. PCR products were amplified using flanking primers (forward 5′-GGCCCAAGATGACATCAGTT-3′, reverse 5′-CTGTTGTTTTTGCTGCTGCT-3′) with AmpliTaqGold360Mastermix (Life Technologies) and the products directly sequenced using the PCR primers on an ABI 3730 capillary sequencer (Life Technologies) after treatment with exonuclease I and shrimp alkaline phosphatase. Sequence data were analyzed using Sequencher 5.1 (GeneCodes).

Murgiano L., Jagannathan V., Benazzi C., Bolcato M., Brunetti B., Muscatello L.V., Dittmer K., Piffer C., Gentile A, & Drögemüller C. (2014). Deletion in the EVC2 Gene Causes Chondrodysplastic Dwarfism in Tyrolean Grey Cattle. PLoS ONE, 9(4), e94861.

+ Open protocol

+ Expand

Bacterial Species Identification via 16S rRNA

Check if the same lab product or an alternative is used in the 5 most similar protocols

To identify the bacterial species, the colonies were picked up with toothpicks, grown in 10 ml liquid MRS medium without antibiotics, and the tubes were incubated overnight at 37 °C on a tube shaker (Thermo Scientific. Inc.). After they were centrifuged, its pellets were subjected to DNA extraction with MidiPrep kit (QIAGEN) and PCR analysis of microbial 16S rRNA genes. Since 16S rRNA gene contains hypervariable species-specific regions, the PCR analysis of this gene can provide signature sequences useful for bacterial identification [14] . The species-specificity of the 16S rRNA genes in microbial colonies was detected by PCR analysis using the following set of primers: 27F (5′-AGAGTTTGATCCTGGCTCAG-3′, nucleotide no. 8–27 [GenBank Accession no. NR_041920]) and 1525R (5′-AAGGAGGTGATCCAGCC-3’, nucleotide no. 1525–1541 [GenBank Accession no. NR_041920]), and this primer set yielded a band of 1499 bp. The amplified DNA fragments were inserted into pGEM-T Easy vector (Life Technologies Corp.), amplified, and sequenced with ABI3730 capillary sequencer (Life Technologies Corp.) using BigDye^® Terminator v3.1 Cycle Sequencing Kit (Life Technologies Corp.).

Ono C., Yoshida M., Kawano N., Miyado K, & Umezawa A. (2015). Staphylococcus epidermidis is involved in a mechanism for female reproduction in mice. Regenerative Therapy, 1, 11-17.

+ Open protocol

+ Expand

Genotyping of PITRM1 Deletion in Dogs

Check if the same lab product or an alternative is used in the 5 most similar protocols

Genotyping of individual dogs was performed either by TaqMan assay (Applied Biosystems) or by Sanger sequencing. The following probes flanking the deletion were used for the TaqMan assay: forward primer 5′-CAGGTGACGGCCATTCCT-3′ and reverse primer 5′-CGCCTGTGCGGTCATG-3′. The reactions were run with the Bio-Rad’s CFX96 Touch Real-Time PCR Detection System instrumentation according to the manufacturer’s instructions. For Sanger sequencing a PCR product was amplified using a forward primer (5′-CAGAAAGAGGGTGCGTAGGA-3′) and a reverse primer (5′-CCCCACACCTGAACAAGTTG-3′) flanking the PITRM1 deletion and AmpliTaq Gold360 Mastermix (Life Technologies). The products were directly sequenced using the PCR primers on an ABI 3730 capillary sequencer (Life Technologies) after treatment with exonuclease I (New England Biolabs) and rapid alkaline phosphatase (Roche). The Sanger sequence data were analyzed using Sequencher 5.4 (GeneCodes).

Hytönen M.K., Sarviaho R., Jackson C.B., Syrjä P., Jokinen T., Matiasek K., Rosati M., Dallabona C., Baruffini E., Quintero I., Arumilli M., Monteuuis G., Donner J., Anttila M., Suomalainen A., Bindoff L.A, & Lohi H. (2021). In-frame deletion in canine PITRM1 is associated with a severe early-onset epilepsy, mitochondrial dysfunction and neurodegeneration. Human Genetics, 140(11), 1593-1609.

+ Open protocol

+ Expand

Genotyping SUV39H2 Variant in HNPK Dogs

Check if the same lab product or an alternative is used in the 5 most similar protocols

The homozygous genotype for SUV39H2:c.972T>G (G/G variant) was confirmed for all HNPK dogs and the homozygous wildtype T/T genotype for the control group on genomic DNA from either deparaffinized tissue or EDTA-blood. The isolation of genomic DNA from paraffin embedded tissue samples was carried out by standard methods using the DNeasy Blood & Tissue Kit (QIAGEN, Hilden, Germany) combining the protocol for pretreatment of paraffin-embedded tissue and the spin-column protocol for purification of total DNA from animal tissue as recommended by the manufacturer. The associated variant was genotyped by re-sequencing of PCR products using Sanger sequencing technology. PCR products were amplified using AmpliTaq Gold 360 Mastermix (Life Technologies, Zug, Switzerland), and the primers SUV39H2_Ex4_FS 5’TCCTCAACTATGGACAAATCGTT3’ and SUV39H2_Ex4_RS 5’TCTCTTTGATCTGGATTATGAATCTG3’. The products were directly sequenced on an ABI 3730 capillary sequencer (Life Technologies, Zug, Switzerland) after treatment with exonuclease I (New England Biolabs, Ipswich, MA, USA) and rAPid alkaline phosphatase (Roche, Basel, Switzerland). Sequence data were analyzed with Sequencher 5.1 (GeneCodes Corporation, Ann Arbor, MI, USA).

Bannoehr J., Balmer P., Stoffel M.H., Jagannathan V., Gaschen V., Kühni K., Sayar B., Drögemüller M., Howald D., Wiener D.J., Leeb T., Welle M.M., Müller E.J, & Roosje P.J. (2020). Abnormal keratinocyte differentiation in the nasal planum of Labrador Retrievers with hereditary nasal parakeratosis (HNPK). PLoS ONE, 15(3), e0225901.

+ Open protocol

+ Expand

Sanger Sequencing of KCNJ10 Variant

Check if the same lab product or an alternative is used in the 5 most similar protocols

Sanger sequencing was used to confirm the variant identified from whole genome sequencing. For these experiments we amplified PCR products from genomic DNA using AmpliTaqGold360Mastermix (Life Technologies). The PCR primers used for the genotyping of the KCNJ10:c.986T>C variant were AGCTGGTGCTGATCCTCAGT (forward primer) and TCCCTTAACGACTCCTCCAA (reverse primer). PCR products were directly sequenced on an ABI 3730 capillary sequencer (Life Technologies) after treatment with exonuclease I and shrimp alkaline phosphatase. Sanger sequence data were analyzed with Sequencher 5.1 (GeneCodes).

Mauri N., Kleiter M., Leschnik M., Högler S., Dietschi E., Wiedmer M., Dietrich J., Henke D., Steffen F., Schuller S., Gurtner C., Stokar-Regenscheit N., O’Toole D., Bilzer T., Herden C., Oevermann A., Jagannathan V, & Leeb T. (2016). A Missense Variant in KCNJ10 in Belgian Shepherd Dogs Affected by Spongy Degeneration with Cerebellar Ataxia (SDCA1). G3: Genes|Genomes|Genetics, 7(2), 663-669.

+ Open protocol

+ Expand

Genotyping LOXHD1 Variant in Dogs

Check if the same lab product or an alternative is used in the 5 most similar protocols

Genotyping of individual dogs was performed with PCR followed by Sanger sequencing. The DNA template was amplified using a forward primer (5′–GCTGTGTGTTGGAGAAGCAA–3′) and a reverse primer (5′–TAGTTGCCTGACACCCTGAG–3′) flanking the LOXHD1 variant with Taq polymerase (Biotools B&M Labs, S.A.). The products were directly sequenced using the PCR primers on an ABI 3730 capillary sequencer (Life Technologies) after treatment with exonuclease I (New England Biolabs) and rapid alkaline phosphatase (Roche Diagnostics). The Sanger sequence data were analyzed using either Sequencher 5.4 (GeneCodes) or Unipro UGENE v1.32.0 (Rose et al. 2019 (link); Okonechnikov et al. 2012 (link); Golosova et al. 2014 (link)).
A sample of 28,116 dogs, including 374 different breeds (Online Resource 7), was submitted for commercial genetic testing at Genoscoper Laboratories (Wisdom Health Finland) during 2017–2020. Another study sample of 771,864 mixed-breed dogs was screened using Wisdom Panel™ (Wisdom Health, WA, USA) genetic testing, including breed detection assessment, during 2019–2021.

Hytönen M.K., Niskanen J.E., Arumilli M., Brookhart-Knox C.A., Donner J, & Lohi H. (2021). Missense variant in LOXHD1 is associated with canine nonsyndromic hearing loss. Human Genetics, 140(11), 1611-1618.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!